Ecology

Associations

Fungus / saprobe
fruitbody of Collybia cirrhata is saprobic on decaying basidiome of Pholiota

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:77Public Records:40
Specimens with Sequences:52Public Species:26
Specimens with Barcodes:51Public BINs:0
Species:41         
Species With Barcodes:32         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pholiota cf. spumosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGCTTTTCGGTTTTAATTAGATTAGAATTATCTTCTCCAGGTGTTCAATTTTTACAAGGAGACCACCAACTATTTAATGTTATAATTTCTGCTCATGCTTTTATAATGATTTTTTTTATGGTTATGCCTGGTTTAGTAGGTGGATTTGGTAATTATTTTTTACCTATTCACTGTGGTAGTCCAGATATGGCATTCCCAAGATTAAATAATGTATCATTCTGGCTTTTACCACCAGCTTTAATATTATTATTAATGAGTTCATTAGTAGAAAATGGAGCTGGTACAGGATGAACTGTTTATCCTCCATTAGCAGGTATCCAATCACATTCCGGAGGTTCAGTAGATTTAGCTATTTTCAGTTTACATTTAGCTGGTATATCTTCTTTACTAGGTGCTGTTAATTTTATAAGTACTACTTTAAATATGAGAACTAATGGTATGTCTTTACATAAATTGCCTTTATTCGTATGGGCTATTTTTGTTACAGCTATATTATTATTATTATCATTACCTGTTTTGGCCGGTGCAATCACAATGCTTCTTACAGATAGAAACTTTAATACTAGTTTCTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pholiota cf. spumosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Pholiota

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pholiota

Pholiota is a genus of small to fleshy mushrooms in the family Strophariaceae. The genus has a widespread distribution, especially in temperate regions, and contains about 150 species.[2]

Pholiota is derived from the Greek word pholis, meaning "scale".[3]

Taxonomic details[edit source | edit]

The genus Pholiota is defined as mushrooms, with a glutinous cap surface, growth on wood, and spores which are brown in deposit. These spores are smooth with a germ pore, although the germ pore can be quite narrow in species.

Selected species[edit source | edit]

References[edit source | edit]

  1. ^ "Pholiota (Fr.) P. Kumm. 1871". MycoBank. International Mycological Association. Retrieved 2011-12-23. 
  2. ^ Kirk PM, Cannon PF, Minter DW, Stalpers JA. (2008). Dictionary of the Fungi (10th ed.). Wallingford: CABI. p. 524. ISBN 978-0-85199-826-8. 
  3. ^ Rea, Carleton (1922). British Basidiomycetaceae: a Handbook to the Larger British Fungi. Cambridge, UK: Cambridge University Press. p. 61. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!