Ecology

Associations

Fungus / saprobe
fruitbody of Collybia cirrhata is saprobic on decaying basidiome of Pholiota

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:97
Specimens with Sequences:95
Specimens with Barcodes:91
Species:46
Species With Barcodes:45
Public Records:57
Public Species:33
Public BINs:0
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pholiota cf. spumosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGCTTTTCGGTTTTAATTAGATTAGAATTATCTTCTCCAGGTGTTCAATTTTTACAAGGAGACCACCAACTATTTAATGTTATAATTTCTGCTCATGCTTTTATAATGATTTTTTTTATGGTTATGCCTGGTTTAGTAGGTGGATTTGGTAATTATTTTTTACCTATTCACTGTGGTAGTCCAGATATGGCATTCCCAAGATTAAATAATGTATCATTCTGGCTTTTACCACCAGCTTTAATATTATTATTAATGAGTTCATTAGTAGAAAATGGAGCTGGTACAGGATGAACTGTTTATCCTCCATTAGCAGGTATCCAATCACATTCCGGAGGTTCAGTAGATTTAGCTATTTTCAGTTTACATTTAGCTGGTATATCTTCTTTACTAGGTGCTGTTAATTTTATAAGTACTACTTTAAATATGAGAACTAATGGTATGTCTTTACATAAATTGCCTTTATTCGTATGGGCTATTTTTGTTACAGCTATATTATTATTATTATCATTACCTGTTTTGGCCGGTGCAATCACAATGCTTCTTACAGATAGAAACTTTAATACTAGTTTCTAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pholiota cf. spumosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pholiota

Pholiota is a genus of small to medium sized, fleshy mushrooms in the family Strophariaceae. The genus has a widespread distribution, especially in temperate regions, and contains about 150 species.[2]

Pholiota is derived from the Greek word pholis, meaning "scale".[3]

Taxonomic details[edit]

The genus Pholiota includes mushrooms, with scaly, glutinous to dry cap surfaces, and that frequently grow on wood or at the bases of trees or on decaying tree roots, and spores which are brown, light brown, or yellowish brown in deposit. These spores are smooth with a germ pore, although the germ pore can be quite narrow in species. Usually the species have pleurocystidia which include a type called chrysocystidia. There have been several varying concepts of the genus, ranging from a pre-molecular era very broad concept[4] that nowadays would include the genera Phaeolepiota, Phaeonematoloma, Flammula, Meottomyces, some Stropharia species, some Hypholoma species, Hemipholiota, Hemistropharia, some Kuehneromyces and some Phaeomarasmius, etc. Currently the genus is restricted to a smaller but still large group of species[5][6][7][8] that primarily grow on wood, causing a white rot, but other taxa occur on burnt ground following forest fires or camp fires, on peaty or forest soil, but none are known to be mycorrhizal. Many species have prominent partial veils and form an annulus or annular ring on their stems. None of the species have purplish or purplish brown spore prints. None form acanthocytes on their mycelia.

Selected species[edit]

References[edit]

  1. ^ "Pholiota (Fr.) P. Kumm. 1871". MycoBank. International Mycological Association. Retrieved 2011-12-23. 
  2. ^ Kirk PM, Cannon PF, Minter DW, Stalpers JA. (2008). Dictionary of the Fungi (10th ed.). Wallingford: CABI. p. 524. ISBN 978-0-85199-826-8. 
  3. ^ Rea, Carleton (1922). British Basidiomycetaceae: a Handbook to the Larger British Fungi. Cambridge, UK: Cambridge University Press. p. 61. 
  4. ^ Smith AH and Hesler LR. (1968). "The North American Species of Pholiota". New York, NY: Hafner Publ. Co. 
  5. ^ Moncalvo JM, Vilgalys R, Redhead SA, Johnson JE, James TY, Catherine Aime M, Hofstetter V, Verduin SJ, Larsson E, Baroni TJ, Greg Thorn R, Jacobsson S, Clémençon H, Miller OK Jr. (2002). "One hundred and seventeen clades of euagarics". Molecular Phylogenetics and Evolution 23 (3): 357–400. doi:10.1016/S1055-7903(02)00027-1. PMID 12099793. 
  6. ^ Walther G, Garnica S, Weiß M. (2005). "The systematic relevance of conidiogenesis modes in the gilled Agaricales". Mycological research 109 (5): 525–44. doi:10.1017/S0953756205002868. PMID 16018308. 
  7. ^ Matheny PB, Curtis JM, Hofstetter V, Aime MC, Moncalvo JM, Ge ZW, Slot JC, Ammirati JF, Baroni TJ, Bougher NL, Hughes KW, Lodge DJ, Kerrigan RW, Seidl MT, Aanen DK, DeNitis M, Daniele GM, Desjardin DE, Kropp BR, Norvell LL, Parker A, Vellinga EC, Vilgalys R, Hibbett DS. (2006). "Major clades of Agaricales: a multilocus phylogenetic overview" (PDF). Mycologia 98 (6): 982–95. doi:10.3852/mycologia.98.6.982. PMID 17486974. 
  8. ^ Redhead SA. (2013). "(2128) Proposal to conserve the name Flammula (Fr.) P. Kumm.(Fungi: Agaricales) against Flammula (Webb ex Spach) Fourr. (Spermatophyta: Ranunculaceae)". Taxon 62 (2): 401–402. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!