Overview

Brief Summary

North American Ecology (US and Canada)

Hamadryas guatemalena is found in North America only as an occasional stray in to s. Texas from Mexico; it ranges south to Costa Rica (Scott 1986). Habitats are tropical open areas with trees. Host plants are restricted to one vine species: Dalechampia scandens (Euphorbiaceae) in Central America. Eggs are laid on the host plant singly, or in a stack of two or three. There are multiple flights all year in Mexico (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed on rotten fruit, manure, sap, and occasionally on flowers. Males perch for females and make a cracking sound (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hamadryas guatemalena

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCCCTTAGTTTATTAATTCGTACAGAATTAGGAAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATCGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTCTACCCCCGTCACTAATTTTATTAATTTCTAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTGTACCCCCCACTCTCATCAAATATTGCTCATGGAGGTTCTTCAGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCTTCAATCTTAGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAATAACATATCTTTTGACCAAATACCTTTATTCGTATGAGCTGTAGGTATTACAGCTTTATTATTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATCTTAATACTTCCTTTTTTGATCCAGCTGGAGGAGGTGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hamadryas guatemalena

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hamadryas guatemalena

The Guatemalan Cracker or Guatemalan Calico (Hamadryas guatemalena) is a butterfly of the family Nymphalidae. It is found in Southern North America ranging to Central South America.

The wingspan is 76–98 mm. The butterfly flies year round in the tropical parts of its range and in August in the temperate part of its range.

The larvae feed on Euphorbiaceae species. The adults feed on juices from rotting fruit and animal faeces.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!