Overview

Brief Summary

Introduction

A neotropical fruit-feeding nymphalid.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Smyrna blomfildia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTGGGAAATCCTGGATCATTAATTGGTAAT---GATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATATTAGGAGCCCCTGATATAGCTTTTCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCATCATTAGTTTTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTCTCATCTAATATTGCTCACAGAGGATCTTCTGTTGATTTAGCTATTTTCTCTTTACATTTAGCTGGAATTTCTTCCATTTTAGGAGCAATTAATTTTATTACAACAATCATTAATATACGAATTAATAACATATCATTTGATCAAATACCATTATTTATTTGAGCAGTAGGTATCACAGCATTACTTTTATTATTATCATTACCTGTATTAGCTGGAGCTATTACCATATTATTAACAGATCGAAATATTAATACCTCATTTTTTGATCCTGCCGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTNNNNNNNNNNTATATATTTTAATTTTACCTGGATTTGGTATAATTTCTCATATTATTTCTCAAGAAAGAGGAAAAAAAGAAACTTTTGGATGTATAGGAATAATTTATGCAATAATAGCAATTGGATTATTAGGTTTCATTGTATGAGCTCATCATATATTCACAGTAGGTATAGATATTGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Smyrna blomfildia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Smyrna blomfildia

Smyrna blomfildia, common name Blomfild's Beauty, is a species of butterfly in the Nymphalidae family.

Subspecies[edit]

  • Smyrna blomfildia blomfildia Fabricius, 1793 (Brazil)
  • Smyrna blomfildia datis Fruhstorfer, 1908 (Mexico to Panama)

[2]

Description[edit]

Smyrna blomfildia has a wingspan of about 75–90 millimetres (3.0–3.5 in). The basic color of the wings is red-orange in males, brown in females. The upperside of the forewings show a black apex with three white spots. The underside of hindwings has brown and tan wavy markings with a few submarginal spots.[3]

Mounted specimen of Smyrna blomfildia

The larvae are black, with a bright orange head and strong spines along the white sides.[4] They feed on Urticaceae (Urticastrum, Urrera baccifera),[2] while adults feed on rotting fruits. Males of these butterflies are usyally seen in large aggregations imbibing mineralised moisture.[5]

Distribution and habitat[edit]

Blomfild's Beauty can be found from South Texas and Mexico to Peru through Central America. These butterflies live in tropical forests [2] at an elevation of 0–1,200 metres (0–3,937 ft) above sea level.[5]

References[edit]

  1. ^ Biolib
  2. ^ a b c Funet
  3. ^ Butterflies and Moths of North America
  4. ^ Smyrna blomfildia datis larva
  5. ^ a b Learn about butteflies
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!