Articles on this page are available in 1 other language: Arabic (1) (learn more)

Ecology

Associations

Foodplant / saprobe
colony of Fusarium anamorph of Fusarium is saprobic on dead Herbaceous Plants

Fungus / associate
colony of Fusarium anamorph of Fusarium is associated with Sphacelium anamorph of Claviceps purpurea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:3353
Specimens with Sequences:3310
Specimens with Barcodes:2407
Species:927
Species With Barcodes:923
Public Records:3286
Public Species:921
Public BINs:0
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Fusarium cf. avenaceum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAATACAGTGACATTTTAAAGGATTGGGCAATCAGCCAGAAACCAAAGATAACTTAGTTATCAAGTAGGATCTTCAGAGACTACACGTGAAATATCTTAGWGAATATTTTATAATATTCAAAGATAAAGATATAGTCCGTTCATATTCGAAAGATTATGAGTAAACGTATGCCTGCATTAATTGGGGGATTTGGAAATTTCTTAATGCCTTTAATGGTAGGTGGTCCCGATATGGCATTCCCTAGATTAAATAATATAAGTTTCTGATTATTACCTCCTAGTTTATTATTATTAGTCTTCTCTGCTTGTATTGAAGGTGGAGTGGGAACAGGTTGAACACTTTATCCACCATTATCTGGATTACAGAGTCATAGTGGACCAAGTGTAGATCTTGCTATTTTTACTTTACATTTAACTGGGGTAAGTAGTTTATTAGGATCAATAAATTTTATAACAACTATYGTAAATATGAGAACACCAGGAATAAGATTACATAAATTAGCATTATTTGGATGAGCAGTAGTTATAACAGCAGTATTACTTTTATTATCATTACCTGTATTAGCTGGTGGTATAACTATGGNATTGACAGATAGAAATTTTAATACATCATTCTTTGAAGTAGCCGGTGGTGGAGATCCTATATTATTCCAACACTTATTCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fusarium cf. avenaceum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Fusarium cf. heterosporum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACAGCTCACGCTATATTAATGATATTCTTCATGGTCGACAATTGAAGACAATTTAATCTTAATTTTCAAGCTCCGAGGAGCTCTTAATAACGAAAACAATACTATTACTATTACAAATAGTAGTAATAACAATAGAGCTTCGCGCCCTAATAAAAATAACGATGAAGACAAAATACCGCAATACACTAAAGTATGCATAGAAAACCCTTTTAATAATAGAAATCTTATCTTAAAAGTATCGAAAAATCAAAAAGGTGTTTATATTTGAAAAAGTAATGATCATGCTTATGTAGGACATTCTATTAATTTGTATAATAGAATAAGTTCTTACTTTATGCCATCTATTCTTCAAACTAAAGCACGTAGAGTGTTACGTTATTTTAATAAACACGGATTTCAAGATACAAATCTTACAATTTATATAATGGATGAAAATTCTAGCTTAGAAGAAATTGTAAGCTTAGAACAACATTTTATAGATACTTTAAACCCAAGTCTAAACGTAGATTTGGTGGCAAGTAGTTCAGGTTATCATGAACCAATGAGCCAAGAAATAAGAGATAGATTACGTACACAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fusarium cf. heterosporum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!