Articles on this page are available in 1 other language: French (2) (learn more)

Overview

Brief Summary

North American Ecology (US and Canada)

Nymphalis antiopa is a resident of most of North America from northern Canada and Alaska to Venezuela, and is migratory in some parts of its range. It also occurs throughout Eurasia (Scott 1986). Habitats are deciduous woodland and suburbs from the subtropics to the edge of the arctic tundra. Host plants are mostly trees and include species from many families, including Saliceae, Betulaceae, Aceraceae, Ulmaceae, Moraceae, Oleaceae, Rosaceae, Tiliaceae, Polygonaceae, Aparganiacea. Eggs are laid on the host plant in clusters with up to 250 eggs per clutch. Individuals overwinter as adults. There are variable number of flights each year depending on latitude with one in the northern parts of the range and in high mountains, occurring in late July, two flights further south, occurring late June to Aug. 15, and in the furthest southern part of their range there are probably three flights (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

General Description

The deep brown upperside rimmed with blue spots and a powder-yellow margin is unmistakable. Spring specimens are flight-worn and are faded to maroon-brown with yellowish-white margins. The Mourning Cloak is remarakbly consistent in appearance across its vast North American range, and there are no recognized subspecies (Layberry et al. 1998, Guppy & Shepard 2001). 
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

This species has a wide distribution throughout the northern hemisphere, occuring from Great Britain across Eurasia and from Alaska south to central Mexico (Opler 1999).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Mourning Cloak occupies an area in North America defined by the tundra line in Canada and Alaska in the north and the region of central Mexico in the south. Its range may extend further southward to northern South America, but it is not native to subtropical locales. Thus, it is usually not found in the southern regions of the states of Texas, Florida, and Louisiana. The Mourning Cloak also inhabits northern Eurasia, where some individuals may wander to England, and the temperate zones of Asia, even as far as Japan (Moucha, 1963; Pyle, 1981; Tveten and Tveten, 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic. Occurs in virtually all of North America, except for very dry areas and the high Arctic. Overwinters successfully in most of range but perhaps not in coldest parts and may be present in winter only in some southern areas. Also extends south to Venezuela.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Mourning Cloak has a wing span of 2.875 to 3.375 in. Its dark maroon wings are characterized by a ragged creamy yellow margin that is lined on the interior by bright blue iridescent spots. When viewed closely, the wings appear to be iridescent as they reflect purple highlights. A rare variation in the appearance of the dorsal side of the wings, in which the margin is wider than normal and the blue spots may be absent, sometimes occurs. This aberration is a result of the pupa's being exposed to unusually cold temperatures. The ventral surface of the Mourning Cloak is a striated pattern of gray-black outlined by a yellow wing margin similar to that found on its dorsal surface (Holland, 1910; Pyle, 1981; Tveten and Tveten, 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Found in virtually all habitats throuhgout the province, particularly near moist and riparian woods.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Mourning Cloak occupies "watercourses, sunny glades, forest borders, parks, gardens, open woodlands, and groves" (Pyle, 1981). During hibernation, it may be found "under the eaves of houses, in cellars, crevices and hollows" (Moucha, 1963).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Adults occur in almost any kind of woods or forest and larvae are on the foodplants in or near these habitats. Females will oviposit on willows in rather open situations. In some coastal plain areas (e.g along Delaware Bay) dense mixed swamps are important hibernation areas even though there are often no breeding habits nearby.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

The larvae feed on various trees including elm (Ulmus spp.) and poplars (Populus spp.), and particularly willows (Salix spp.) (Layberry et al. 1998). Adults prefer tree sap and mammal scat to flower nectar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The caterpillar of the Mourning Cloak feeds in groups on the leaves of deciduous trees, including the willow, elm, hackberry, cottonwood, poplar, rose, birch, and mulberry trees. The adult butterfly feeds on tree sap by landing above the flow of sap on a tree and bending its head downward to siphon it. It also feeds on rotting fruit. It very rarely feeds on flowers, but, in the summer, the butterfly may feed on the nectar of scabious and knapweed (Klots, 1951; Pyle, 1981; Tveten and Tveten, 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Nymphalis antiopa in Illinois

Nymphalis antiopa Linnaeus: Nymphalidae, Lepidoptera
(observations are from Robertson and Graenicher; this butterfly is the Mourning Cloak)

Aceraceae: Acer saccharum [oozing sap] (Rb); Asclepiadaceae: Asclepias syriaca [plpr sn] (Rb); Asteraceae: Aster lanceolatus sn (Gr), Eupatoriadelphus purpureus sn (Gr), Euthamia graminifolia sn (Gr); Salicaceae: Salix humilis [stam sn] (Rb); Thymelaeaceae: Dirca palustris sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed on flower nectar, sap, fruit and mud. Males perch for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

One brood per year, appearing in early spring (April to May) and again in August to October.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The eggs are laid in clusters on the hostplant, and the caterpillars initially live in colonies (Scott 1986). The larvae possess branched spines, and are velvety black with small white spots and a line of dorsal red spots (Guppy & Shepard 2001). The adults are one of the longest-lived species in Alberta, and can live to be nearly a year old since they hatch in July or August, overwinter, and are occasionally found into June of the following year. Because they sometimes appear on warm winter days, Mourning Cloaks can be seen in almost any month of the year.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Butterflies undergo complete metamorphosis. The first stage of this process is represented by the egg. The Mourning Cloak lays its eggs in clusters of rings around twigs. The pale colored egg is 0.9 x 0.7 mm and becomes black prior to hatching; this event reveals the second stage of the process, the caterpillar. The caterpillar can grow up to 2 in long and is velvety black with raised white dots and a row of red spots on its mid-dorsal region. The caterpillar's legs are the color of rust, and several long black spines line its body. It associates in groups. The caterpillar undergoes four ecdyses, instances in which the caterpillar sheds its skin. Each ecdysis is called an instar. A fully grown caterpillar has gone through five instars. The latitude and altitude of the population's geographic location determines the number of broods, usually two or three. The next stage is the chrysalis. The chrysalis of the Mourning Cloak hangs upside down from grass stems; the tip of its abdomen is adjoined to the leaf by a silk pad produced by the caterpillar. It may grow up to 28 mm long and its color ranges from tan to gray. It has two head horns, a "beak," and tubercles that run the length of its body. The final stage is the adult butterfly (Feltwell, 1986; Klots, 1951; Moucha, 1963; Pyle, 1981; Tveten and Tveten, 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nymphalis antiopa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACATCTCTCAGTTTATTAATTCGAACTGAGTTAGGAAATCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACAATTGTCACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCACCAGATATAGCCTTTCCACGAATAAATAATATAAGATTTTGACTTCTTCCCCCATCATTAATTTTATTAATTTCTAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCCCTTTCCTCTAATATTGCTCATAGAGGAGCTTCAGTAGATTTAGCAATTTTTTCCTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAACTTTATTACAACAATTATCAATATACGAATTAATAATATATCTTTTGACCAAATACCTCTATTTGTATGAGCTGTAGGAATCACAGCCTTACTTCTTTTACTTTCTCTTCCTGTTTTAGCTGGAGCTATTACTATACTCCTTACAGACCGTAATATTAATACATCATTTTTCGACCCCGCAGGAGGAGGTGACCCTATTCTTTACCAACATTTATTTTGATTTTTTGGTNNNNNNNNNNTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCCCATATTATTTCACAAGAAAGAGGAAAAAAAGAAACTTTTGGTTGTCTAGGAATAATTTATGCTATGATAGCAATTGGATTATTAGGATTTATTGTATGAGCACATCATATATTTACAGTAGGTATAGATATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nymphalis antiopa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 80
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Mourning Cloak enjoys legislative protection in Austria and Switzerland (Feltwell, 1986).

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread holarctic species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Canada has designated the caterpillar of the Mourning Cloak as a pest that attacks deciduous trees (Moucha, 1963).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

While the Mourning Cloak's function as a pollinator is minimal because the Mourning Cloak does not usually feed on flowers, it is still existent.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nymphalis antiopa

Nymphalis antiopa, known as the Mourning Cloak in North America and the Camberwell Beauty in Britain, is a large butterfly native to Eurasia and North America. See also Anglewing butterflies. The immature form of this species is sometimes known as the spiny elm caterpillar. Other older names for this species include Grand Surprise and White Petticoat. A powerful flier, this species is sometimes found in areas far from its usual range during migration. It is also the State Insect of Montana.

Contents

Subspecies [edit]

  • N. a. antiopa (Linnaeus, 1758)
  • N. a. hyperborea (Seitz, 1914) (Alaska)
  • N. a. asopos (Fruhstorfer, 1909) (Japan)

Appearance and Behaviour [edit]

Nymphalis antiopa has a wingspan of 62–75 mm. The upper side of the butterfly is colored in a very dark red, with a bright, yellowish border around the wings. There is a darker band with bright blue spots between the border and the dark red inner side. Sexes are similar, although the females are slightly larger.

These butterflies lay eggs in clusters around twigs of their favored food plants, in Europe, generally Grey Willow (Salix cinerea) and in North America, generally Black Willow (Salix nigra) but also other willow species, as well as poplar, elm, birch, and hackberry. The larvae feed gregariously, and are black and spiny, with fine white speckles, and a row of red spots running down the back. They disperse to pupate and emerge after about three weeks. Soon after emergence, they will disperse further from their breeding grounds in order to find food (sometimes nectar, but more commonly tree sap) to build up fat stores for hibernation, and will often enter parks and gardens to do so. They are single-brooded and hibernate as adults.

Throughout its range, this species is generally considered a butterfly of woodlands, though it may occasionally be found in drier areas such as the deserts of western North America. During migration, they may be found in almost any habitat. The Mourning Cloak was adopted as the state butterfly of the State of Montana in 2001.

Distribution [edit]

In North America, N. antiopa ranges from the northern tundra to central Mexico. It is also found throughout continental Europe to eastern Siberia and Japan. Migrants arrive in Great Britain most years during summer and autumn, but numbers are usually very low. There is no evidence that the species breeds in Britain; it is thought that mild, wet winters prevent them from surviving there for very long. The 'Butterfly Farmer' L. Hugh Newman raised thousands for release at his 'farm' in Bexley, but none were seen the following spring. Specimens stored in his refrigerator for the winter survived however.

Etymology [edit]

The North American name "Mourning Cloak" [edit]

In several European countries with Germanic languages, other than Britain, the name for this butterfly literally translates to "Mourning Cloak", such as German "Trauermantel", Swedish "sorgmantel", and Norwegian "Sørgekåpen". This suggests it is a name which came with Scandinavian or German rather than with British settlers, for whom this species would be considerably less familiar.

The British name "Camberwell Beauty" [edit]

The name originated from the discovery of two individuals at Coldharbour Lane in Camberwell in August 1748. Camberwell is in South London, about three miles south of London Bridge—in reporting this, the author Harris named the species Grand Surprise or Camberwell Beauty (Bretherton & Emmet, 1990). It has been suggested that the "pair" were stowaways on ships bringing timber from Scandinavia.

In popular culture [edit]

The poem Unconscious came a beauty by May Swenson mentions the Mourning Cloak (or the similar looking Red-spotted Purple) – a butterfly that makes her pause and think, while writing. The poem is also a word-picture or iconograph – the lines are laid out to look like a butterfly. In the Doomspell Trilogy by Cliff McNish, Camberwell Beauties are the main icon of the baby Yemi. They act as his protectors and guides and Yemi's magic enlarges them to the size of cats.

References [edit]

  • "Nymphalis antiopa". Integrated Taxonomic Information System. Retrieved 8 February 2006. 
  • Asher, Jim. The Atlas of Butterflies of Britain and Ireland, Oxford University Press.
  • Bretherton, R.F.; Emmet, A.M. (1990). NYMPHALIS ANTIOPA (Rottemburg). Pages 206–209 in Emmet, A.M., J. Heath et al. (Eds.) The Butterflies of Great Britain and Ireland. The Moths and Butterflies of Great Britain and Ireland Vol. 7 Part 1 (Hesperiidae to Nymphalidae). Harley Books, Colchester, UK. 370p. 
  • Darby, Gene (1958). What is a Butterfly. Chicago: Benefic Press. p. 32. 
  • Thomas, Jeremy, and Richard Lewington. The Butterflies of Britain and Ireland, Dorling Kindersley.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!