Overview

Brief Summary

North American Ecology (US and Canada)

Junonia coenia is native to the southern United States and coastal California, and migratory throughout most of the rest of the states and into southern Canada (Scott 1986). Habitats are subtropical to upper Sonoran and upper austral zone in open areas and weedy places. Host plants are herbaceous, and include species from many families, including Plantaginaceae, Scrophulariaceae, Verbenaceae, Acanthaceae, and Cornaceae. Eggs are laid on the host plant singly. Individuals overwinter as larvae, and perhaps adults, but only in California lowlands. There are multiple flights all in Florida, Texas and southern California, and migrations northward mostly occur June 1-Oct. 31 (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

This species occurs in southern Canada east of Saskatchawan, and throughout the United States except for Montana, Idaho, Washington, and western Wyoming. From there it ranges south and east to Bermuda, the Bahamas, Cuba, nearly all of Mexico except southern Baja California.

Biogeographic Regions: nearctic (Native )

Other Geographic Terms: island endemic

  • Scott, J. 1986. The Butterflies of North America. Stanford, California, USA: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Resident throughout the southern United States. Migrates northward to Oregon, Ontario, New England. Absent from Rocky Mountains. Also occurs in northern Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The eggs of Junonia coenia are a dark green.

The larva that hatch from the eggs are nearly black and have two rows of orange-cream spots along the middorsal. There are two lateral rows of cream spots and the larva has many bluish-black spines. The prolegs are orange. The head is black with an orange spot toward the anterior and two short black spines on top, and orange on the top and sides.

Pupa color varies from light color with brownish-orange blotches, to entirely brownish-orange, to nearly black.

The adult stage of the butterfly has brown wings with three eyespots per wing, one on the upper and two on the hindwing. There are characteristic orange bands on the forewing. They have a particularly large eyespot on the hindwing that is reddish to purple. Adult coloration varies, with a form called "rosa," (with red under-hindwings) that appears late in the fall in eastern U.S., and may be a result of short daylength or lower temperatures.

Range wingspan: 4 to 6 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

  • Holland, W. 1997. The Butterfly Book. New York, NY: Doublebay, Page and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Junonia coenia tends to like more open areas such as fields, parks, pastures, meadows, and coastal dunes. You can also find them along roadsides and in other disturbed, weedy places. They are often near their food plants, and may also feed or drink around mud puddles.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; chaparral ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open fields, weedy areas, vacant lots, roadsides, right of ways, swamp edges and beach dunes. Needs habitats with some areas of bare ground. Not in forest but does occur and breed in wooded edges, savannas etc. Many hosts primarily plaintains and many Scropulariaceae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Adults feed mainly on nectar, and occasionally on mud from the edge of puddles (probably for salts and other minerals).

Caterpillars feed on a wide variety of host plants, nearly all herbaceous (see partial list below). Females may be stimulated to oviposit by the presence of iridoid glycosides (Kluts, 1951, Scott, 1986).

Foods eaten: plantains (Plantago), gerardia, toadflax (Linaria), wild snapdragons (Antirrhinum),  false loosestrife (Ludvigia), stonecrop (Sedum).

Plant Foods: leaves; nectar

Primary Diet: herbivore (Folivore , Nectarivore )

  • Kluts, A. 1951. A Field Guide to Butterflies of North America East of the Great Plains. Boston, Massachusetts, USA: Houghton Mifflin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Junonia coenia in Illinois

Junonia coenia Hübner: Nymphalidae, Lepidoptera
(observations are from Robertson, Hilty, and Clinebell; this butterfly is the Common Buckeye)

Asclepiadaceae: Ampelamus albidus [plup sn] (H), Asclepias verticillata [plup sn] (H); Asteraceae: Aster pilosus sn (Rb), Boltonia asterioides sn (Rb), Eupatorium altissimum sn (H), Liatris aspera (Cl), Oligoneuron rigidum sn (H); Lamiaceae: Pycnanthemum tenuifolium sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Buckeyes, like most butterflies, can be important pollinators.

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults sip flower nectar and mud. Males perch for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Female buckeyes lay eggs individually on buds and leaves of host plants. The larvae (caterpillars) emerge and feed and grow on the host plant, molting several times. Larvae transform into pupae, and spend the winter in this stage in the northern part of the range. Metamorphosis is completed in the pupal case, and fully developed adult butterflies emerge. They can take flight after their wings dry. In the southern half of the range, this species may develop and reproduce continually with no diapause or winter dormancy.

Development - Life Cycle: metamorphosis ; diapause

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Junonia coenia does not live a long time. Adults live about ten days in nature, and about a month in a lab. Larvae and adults may overwinter in warm climates (California lowlands, and regions with similar climate).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males perch on the ground or low plants and watch for passing females. They pursue any likely object. Females inclined to mate will land, and the male will follow. Courtship behavior is variable. Sometimes they land, fold their wings, and mate. On other occasions females have been observed fluttering their wings after landing. The male responds by hovering over her and fluttering his wings as he lands behind her. The male will then pursue her by nudging her from behind. They will then mate, or if she chooses not to mate, she will flap her wings with a high intensity, spread her wings and lift her abdomen to deny him access, or just fly away.

Mating System: polygynous

After mating, female buckeyes lay their eggs on the leaves of host plants that their larvae will eat. In the northern part of the range there may only be one or two generations a year, and it's unlikely that adults can survive the winter. Further south (Florida, Texas, California and beyond), there are adults flying nearly all year.

Breeding season: Year-round in southern range, narrowing to summer in the north.

Key Reproductive Features: semelparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

There is no parental care in this species.

Parental Investment: no parental involvement

  • Scott, J. 1986. The Butterflies of North America. Stanford, California, USA: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Junonia coenia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGTATAGTAGGAACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGATCATTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAATAGGAGGATTTGGTAATTGATTAGTACCTCTTATATTAGGAGCCCCTGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGACTTCTACCCCCGTCATTAGTATTATTAATTTCTAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCCCATGGAGGATCTTCAGTTGATTTAGCAATTTTCTCGCTTCACTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTGTAAATGGTATATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCATTATTATTAGTTCTTTCATTACCAGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATATTAACACATCATTTTTTGATCCAGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCTGNNNNTTATATTTTAATTTTACCAGGATTTGGTATAATTTCCCATATTATTTCTCAAGAAAGAGGAAAAAAGGAAACCTTCGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGAATAGATATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Junonia coenia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Due to their large abundance, J. coenia is currently not on any endangered species list.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread in south and west; adapts to disturbance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Junonia coenia

The Common Buckeye or simply Buckeye (Junonia coenia) is a butterfly in the family Nymphalidae. It is found in southern Manitoba, Ontario, Quebec, and Nova Scotia and all parts of the United States except the northwest, and is especially common in the south, the California coast, and throughout Central America and Colombia. The sub-species Junonia coenia bergi is endemic to the island of Bermuda.

Its habitat is open areas with low vegetation and some bare ground. This species and its relatives were placed formerly in the genus Precis.

Contents

Description

The bold pattern of eyespots and white bars on the upper wing surface is distinctive in much of its range, though compare related species in the same genus. These are Mangrove Buckeye (Junonia evarete) and Tropical Buckeye (Junonia genoveva), formerly considered one species, and the Smoky Buckeye (Junonia evarete). The eyespots likely serve to startle or distract predators, especially young birds. The species has many flights throughout the year, with mostly northward migrations for the summer. Much of the northern United States is only colonized in the fall from southern populations. Some of the later broods move southwards in the fall. Common Buckeyes exhibit seasonal polyphenism, the summer version of the butterfly has light yellowish ventral wings and is called "linea". The Fall morph has pink ventral wings, and is called the "rosa" morph.

Diet

Adults feed on nectar and also take fluids from mud and damp sand. Males perch on bare ground or low plants, occasionally patrolling in search of females, but they are not territorial. The female lays eggs singly on buds or the upper side of leaves. The caterpillars are solitary and feed on the foliage, flowers, and fruits of the host plant. A variety of (typically) herbaceous plants are used, including especially plants in the snapdragon family (Scrophulariaceae). These include snapdragon (Antirrhinum), toadflax (Linaria), and Gerardia. Caterpillars also feed on plants of the plantain family, such as Plantago; and the Acanthus family including ruellia (Ruellia nodiflora). Larvae feed singly. Adults and some larvae overwinter in southern areas. The pupa may not have a resting phase (diapause), as in many other butterflies.

The Common Buckeye was featured on the 2006 United States Postal Service 24-cent postage stamp.

Gallery

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Hybridizes with other Junonia (see monograph by j. Hafernik, UC Pub Ent.). Widely variable with different seasonal forms.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!