Overview

Brief Summary

North American Ecology (US and Canada)

Speyeria diana is resident in the s. Appalachians from western Va and WV to northeast Ga and the Ark. Ozarks. It is migratory but uncommon elsewhere and became extinct in southeastern Va in 1951 (Scott 1986). Habitats are deciduous and pine woodland near streams. Host plants are herbaceous, limited to a few species of genus Viola (Violaceae). Eggs are laid haphazardly, near the host plant, singly. Individuals overwinter as unfed first instar larvae. There is one flight each year with the approximate flight time June 15-early Aug. (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) As of about year 2003, this species had essentially a two part range in the Appalachians from the Virginias and eastern Kentucky into north Georgia and probably Alabama and separately in the Ozarks and Quachitas of Missouri and Arkansas. Within Arkansas and adjacent regions and its main Appalachian range it is fairly widespread (perhaps less so in West Virginia) and occurrences may be very hard to define. It is now very rare and sporadic or absent elsewhere.

Originally possibly as far north as western Pennsylvania, and certainly west through the Ohio Valley to Illinois, and south to northern Louisiana, although somewhat spotty. Former disjunct coastal plain-eastern piedmont populations of Virginia and North Carolina populations seem to be eradicated. Probably no longer resident in Ohio, Indiana or Illinois. Not now found in Pennsylvania or Maryland but there is no real evidence it was ever established in these states.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

If seen well both sexes are unmistakable, but inexperienced persons sometimes mistake large southern females of S. cybele for male S. diana when seen flying. For the male the plain two-tone brownish underside hindwing with some silver at the margins but no silver spots, and solidly dark basal portion and almost unmarked orange outer third of both wings above are diagnostic. For the female a lack of tails and lack of any orange spots on the hindwing beneath or elsewhere and extensive blue on the hindwing above combined with three rows of white or bluish white (but not yellowish) spots on the forewing above are diagnostic. While a forest understory setting for a larva would suggest this species, for now identifications should not be based on immatures since S. cybele caterpillar is similar (see illustration in Allen, 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Breeding habitat is deciduous or mixed forest with a lot of violetds in the understory in most of the range. In Arkansas oak woodland or savanna, with a lot of violets in the understory are also breeding habitats. While violets do occur in open areas, there is no evidence females oviposit there. James Bess (pers. comm. to Schweitzer, February, 2005) verifies that breeding habitats in Arkansas are wooded, but not as heavily as eastward. In most of the range habitats are generally mesic, such as cove forests, but sometimes bottomlands are also used. Adults also use adjacent fields, pastures, shrublands and grassland for nectar and such places are part of the habitat. In Arkansas, and more widely, breeding habitats and nectaring habitats may be quite different (Moran and Baldridge, 2002) and bothare checked off here. Flower preferences may vary regionally. For example milkweeds are often used farther east and are not noted in this Arkansas study (Table 1).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Adults visit flowers of many species and also scat and moist soil. Larvae of this entire genus feed on foliage of genus VIOLA, probably any species available in the breeding habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Speyeria diana in Illinois

Speyeria diana Cramer: Nymphalidae, Lepidoptera
(this observation is from Bouseman, Sternburg, & Wiker; this butterfly is the Diana Fritillary; information is limited)

Pontederiaceae: Pontederia cordata sn (BSW)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: Very difficult to define and therefore to evaluate occurrences. In good years adults, which move around substantially looking for nectar and live one to possibly four months, are widespread over large tracts of southern Appalachian forest and in limited parts of Arkansas. In poor years they are more localized and occurrence estimates should be based on the latter situation, since these are essentially core areas of unstable metapopulations. It is virtually certain there are many more than 20 substantial metapopulation occurrences by any reasonable definition, and probably over 100, from Virginia to Georgia. The number of occurrences in the Ozarks region and elsewhere is less clear, but at least several.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Comments: Records overestimate abundance due to occasional population build-ups and dispersal and probable occurrence of a lot of DRANK sites at least in good years. There are no useful estimates of numbers but in typical years probably would be C or D.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed on flower nectar and dung. Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: There is one brood in all species of this genus. Adult males begin to emerge in most areas in June and females follow in a couple of weeks. Females persist through most of September at least southward. Oivposition is apparently in late August and September. Larvae hatch in the fall and hibernate without feeding, resuming activity in March or April.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Speyeria diana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GAACATCATTAAGTTTNTTAATCCGAACTGAATTAGGTAACCCAGGGTCATTAATTGGTAATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAACTGATTAGTCCCTCTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGACTTTTACCCCCATCCTTAATTTTACTTATTTCTAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCCCCCCTTTCCTCTAATATTGCACATGGAGGTTCTTCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGTATTTCCTCTATTCTAGGAGCAATTAACTTTATTACTACAATTATTAATATACGGATTAATAAAATATCTTTTGATCAAATGCCATTATTTGTGTGAGCAGTAGGAATTACAGCCTTACTTCTTTTATTATCTTTACCAGTTTTAGCAGGAGCTATTACRATACTTTTAACTGATCGTAATTTAAATACTTCTTTTTTTGACCCTGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Speyeria diana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Considering past range reduction and known current threats to its habitat and from gypsy moth spraying, there is doubt whether this species is secure or not though it does have more than 100 bone fide persistent occurrences and certainly is not now imperiled in the core of its range. Actually occurrences are difficult to define and the number of occurrences is very difficult to evaluate since adults live a long time and apparently are sometimes dispersive. They may be considerably more widespread in good years than in unfavorable years and it is the minimum range in a an area that determines status. It appears there are presently dozens or perhaps hundreds of occurrences centered in eastern Kentucky, western North Carolina, Tennessee and north Georgia with fewer in the Virginias and some substantial populations in the Ozarks and Ouachitas. Potential gypsy moth spraying will be a major concern in the future in the Ozarks and Ouachitas. This species is not imminently imperiled in the southern Appalachians or in Missouri-Arkansas, but considering its past decline and extirpation from several states, and threats in some areas, it is difficult to say whether this species should be called secure over-all. This species was originally substantially more widespread than it is now, for example in coastal Virginia and the Ohio Valley, but it may at one time have been more reduced than it is today since it has recolonized many Appalachian areas that were clearcut in the 1800s or early 1900s.

Intrinsic Vulnerability: Moderately vulnerable

Comments: Populations require substantial adult and larval habitats which may be quite separate. Adults must be able to move between and locate both. Thus this species probably requires much larger and more diverse overall habitats than almost all other butterflies in its range.

Environmental Specificity: Moderate. Generalist or community with some key requirements scarce.

Comments: While acceptable violets occur in many habitats, this species breeds only in forested areas. Adults also need access to flowers which are often in different habitats and especially eastward could be limiting.

Other Considerations: Numbers do fluctuate from year to year like other fritillaries. Some places where the species occurs in some years do not have it in others (e.g. Thomas Allen observations in West Virginia). The adults are mobile and widespread in good years which makes assessment of number of real occurences problematic. More or less a landscape level species in heavily forest southern mountain areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Apparently underwent a major rangewide decline resulting in loss of substantial portion of historic range. However, some workers believe it is again increasing in some areas where second growth forests are becoming mature and where gypsy moth spraying is not presently widespread. It may be less rare now than it was several decades ago in the Ozarks and Quchitas, e.g. compare Heitzman and Heitzman (1987) account with current information and confer the map and discussion in Moran and Baldridge (2002). Obviously loosing habitat every year to summer home and residential development in its core Appalachian range. Apparently not increasing or decreasing more than 10% overall.

Global Long Term Trend: Decline of 50-90%

Comments: Greatly reduced by land clearing and plowing in the 19th and 20th centuries resulting in a moderate overall reduction of range and much greater reduction in numbers. Numbers have clearly recovered some since then but the range was reduced by perhaps 50%. For example the species was virtually eradicated from the Ohio Valley before 1900 and perhaps 50 year later from eastern Virginia and eastern North Carolina, and it does not now occur in those regions. The last known Indiana specimens or observations were before 1891 (Shull, 1987) and Ohio, Pennsylvania, and Maryland records, credible or otherwise, were mostly or all before 1900. Today the two remaining parts of the range are completely isolated by hundreds of kilometers but originally the distribution was probably rather continuous. It is less clear how much this species was reduced in numbers or area of occupancy, although probably more than it was in extent of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: Strip mining and timbering are significant threats at many sites, and deforestation coincided with the substantial reduction in range of this species. However it does recolonize cut over areas when forests grow back. Overall gypsy moth spraying and residential development are probably the biggest current threats at least in the Appalachians. Third instar larvae showed extreme sensitivity to Btk (Peacock et al., 1998). Dimilin would pose an equal or, more likely, even greater threat. Possibly could be impacted locally by defoliation if this resulted in tree mortality, but at least in Appalachia, most good breeding sites are not oak dominated and are unlikely to have high tree mortality caused by by gypsy moth. Even when many trees are left intact, development is likely to obliterate and convert to lawn much of the understory where larvae occur. On the other hand gardens do provide nectar which is possibly sometimes limiting. Invasive exotic weeds like garlic mustard and out of control deer (especially in National Parks) could become serious threats if they reduce foodplant violets or adult nectar plants. Both need to be monitored.

Also lack of available information concerning precisely where major occurrences are located hampers any manager trying to protect them, for example in evaluating Btk spray proposals. Photographers, collectors and reliable watchers should be encouraged to report such areas, especially places where females are regularly found late in the season when they are laying eggs. At least in Appalachia this species has been collected for for six decades or longer at some places without any apparent impact. Normal collecting practices are not a significant threat in the core of the range, and mostly males are taken. Females should be collected with restraint especially before September when they probably have not oviposited yet. In areas where the species is genuinely scarce vouchering of new occurrences should be by male specimen or photographs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Several (4-12) occurrences appropriately protected and managed

Comments: Occurs widely in Great Smokey Mountains National Park and in most Appalalachian National Forests south of central Virginia. Whether or not it is protected in these places from threats such as gypsy moth spraying, exotic plants, and out of control deer is uncertain. Logging practices in National Forest and elsewhere are potential threats depending on details and exact sites involved, but some level of logging should be compatible with this species. Herbiciding of the understory would probably eradicate larval and adult foods.

Needs: Protection of long term population centers is strongly recommended, especially any extant outside of Appalachians. Delete breeding areas from spray blocks or spray with Gypcheck or apply Entomophaga maimaiga. Monitor invasive weeds. Deer management may become critical.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: In many cases no management will be needed. TThis species was a former USFWS C2 species primarily due to concerns about Gypsy Moth spraying, particularly considering the extensive BTK and Dimilin spraying in the central Appalachians in the late1980s and early 1990s. While this threat has not disappeared, current more targeted applications would not be nearly as likely to eradicate Diana populations as those of earlier decades. Larvae of this species are extremely sensitive to BTK (Peacock et al., 1998). It is unlikely Compsilura is a threat since this impacts primarily large summer caterpillars feeding in trees, and Diana larvae feed mostly in spring near the ground. Gypsy Moth larvae do not eat violets but canopy defoliation itself would probably have a one year positive impact on violets and nectar flowers.

As with virtually all butterflies, no stage is protected from fires and prescribed burning in breeding areas should be avoided if practical. Numerous studies and observations document the negative impacts of fire on other fritillary larvae. If some Arkansas habitats really need fires to persist, unburned refugia are essential and several years may be needed for recovery after fires. Prescribed burning in prairie areas where adults nectar could cause significant mortality only if conducted in summer and can substantially improve nectar supply (Rudolph et al, 2006). Generally eastern habitats are not thought of as fire prone, although wild fires could occur. However, given the findings of Rudolph et al., the adequacy of nectar resources in heavily forested eastern habitats should be re-evaluated and might be more limiting than is generally supposed. In some places prescribed burning might be useful for maintaining openings with nectar flowers.

Much of its range now is on US Forest Service and National Park Service lands. The management goal with this species should be primarily maintaining healthy populations in the core of both parts of the range thus preventing another large-scale decline. This does not mean management of large tracts in the Appalachians as Diana Fritillary preserves, but mostly avoiding disturbances from which populations cannot recover and certain practices like herbiciding that destroy understory. Some proactive management might be warranted in areas where this species is rare or probably still recovering from past deforestation events. In general maintaining this species should be compatible with most normal forest management practices other than clearcutting, but there could be conflicts with gyspy moth control. Gypchek would be a safe alternative.

The extent to which selective logging impacts this species (positively or negatively) seems to be poorly understood. Clear cutting eliminates populations although they would liklely reappear in a few decades if the area were to regenerate to native forest with intact understory. While one might assume that all logging is detrimental, it seems plausible that thinning could increase violets, which in turn might increase Diana populations if the habitat remained forested enough for ovipositing females to use. Any silvicultural practices such as herbiciding that would kill violets or nectar plants would be potential serious threats. Excessive deer browsing and roadside mowing could eliminate nectar plants, forcing adults to leave an area. It is not clear whether deer would seriously impact violets. Non-native weeds such as stilt grass, kudzu, mile-a-minute, or garlic mustard that could impact forest violets might be the most serious long-term threat, but more information is needed.

Collecting bans are not warranted in the Appalachian portion of the range at least, and there is no information suggesting actual impacts to populations this species, some of which have been collected for a century now. Nevertheless, it is worth remembering that fresh female Speyeria in July and August have not reproduced and blatant over collecting apparently eradicated a Regal Fritillary colony in Maryland. Collectors should use common sense and collect females sparingly. Both collectors and photographers need to be careful not to damage nectar plants. We suggest those who want a series of fresh specimens consider rearing them or obtaining them from somebody who does, or collecting small numbers in different places or years.

This species was a former USFWS C2 species primarily due to concerns about Gypsy Moth spraying, particularly considering the extensive BTK and Dimilin spraying in the central Appalachians in the late1980s and early 1990s. While this threat has not disappeared, current more targeted applications would not be nearly as likely to eradicate Diana populations as those of earlier decades. Larvae of this species are extremely sensitive to BTK (Peacock et al., 1998). It is unlikely Compsilura is a threat since this impacts primarily large summer caterpillars feeding in trees, and Diana larvae feed mostly in spring near the ground. Gypsy Moth larvae do not eat violets but canopy defoliation itself would probably have a one year positive impact on violets and nectar flowers.

As with virtually all butterflies, no stage is protected from fires and prescribed burning in breeding areas should be avoided if practical. Numerous studies and observations document the negative impacts of fire on other fritillary larvae. If some Arkansas habitats really need fires to persist, unburned refugia are essential and several years may be needed for recovery after fires. Prescribed burning in prairie areas where adults nectar could cause significant mortality only if conducted in summer and can substantially improve nectar supply (Rudolph et al, 2006). Generally eastern habitats are not thought of as fire prone, although wild fires could occur. However, given the findings of Rudolph et al., the adequacy of nectar resources in heavily forested eastern habitats should be re-evaluated and might be more limiting than is generally supposed. In some places prescribed burning might be useful for maintaining openings with nectar flowers.

Much of its range now is on US Forest Service and National Park Service lands. The management goal with this species should be primarily maintaining healthy populations in the core of both parts of the range thus preventing another large-scale decline. This does not mean management of large tracts in the Appalachians as Diana Fritillary preserves, but mostly avoiding disturbances from which populations cannot recover and certain practices like herbiciding that destroy understory. Some proactive management might be warranted in areas where this species is rare or probably still recovering from past deforestation events. In general maintaining this species should be compatible with most normal forest management practices other than clearcutting, but there could be conflicts with gyspy moth control. Gypchek would be a safe alternative.

The extent to which selective logging impacts this species (positively or negatively) seems to be poorly understood. Clear cutting eliminates populations although they would liklely reappear in a few decades if the area were to regenerate to native forest with intact understory. While one might assume that all logging is detrimental, it seems plausible that thinning could increase violets, which in turn might increase Diana populations if the habitat remained forested enough for ovipositing females to use. Any silvicultural practices such as herbiciding that would kill violets or nectar plants would be potential serious threats. Excessive deer browsing and roadside mowing could eliminate nectar plants, forcing adults to leave an area. It is not clear whether deer would seriously impact violets. Non-native weeds such as stilt grass, kudzu, mile-a-minute, or garlic mustard that could impact forest violets might be the most serious long-term threat, but more information is needed.

Collecting bans are not warranted in the Appalachian portion of the range at least, and there is no information suggesting actual impacts to populations this species, some of which have been collected for a century now. Nevertheless, it is worth remembering that fresh female Speyeria in July and August have not reproduced and blatant over collecting apparently eradicated a Regal Fritillary colony in Maryland. Collectors should use common sense and collect females sparingly. Both collectors and photographers need to be careful not to damage nectar plants. We suggest those who want a series of fresh specimens consider rearing them or obtaining them from somebody who does, or collecting small numbers in different places or years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Diana Fritillary

The Diana Fritillary (Speyeria diana) is a butterfly found in several wooded areas in southern and eastern North America (primarily in the Arkansas River valley, several counties in South Carolina, and spots along the Appalachian mountain range). The species exhibits marked sexual dimorphism, with males of the species exhibiting an orange color on the edges of their wings, with a burnt orange underwing. Females are dark blue, with dark, almost dusty underwings, and are also larger than males.[2]

The larvae feed on violet leaves. Dianas are unusual in that they do not lay their eggs directly on the host plant, instead scattering the eggs around the base of the plant. Upon hatching, larvae burrow into the ground over winter to emerge in spring. Adults feed on flower nectar and dung.[2]

On February 28, 2007, Act 156 of the Arkansas General Assembly designated the Diana fritillary as the official state butterfly. Introduced by Representative John Paul Wells of Logan County, the legislation for making the butterfly a state symbol took note of the butterfly’s beauty, educational importance, and impact on tourism. Arkansas is the only state to designate the Diana fritillary as its state butterfly; pairing it with its state insect, the honeybee. Arkansas is the twenty-sixth state to designate a butterfly as a state symbol.[3]

References[edit]

  1. ^ "Speyeria diana Cramer 1779". Retrieved 2009-11-17. 
  2. ^ a b "Diana, Butterflies and Moths of North America". Retrieved 2008-09-15. 
  3. ^ Spencer, Lori. "Mount Magazine State Park". Encyclopedia of Arkansas. Central Arkansas Library System. Retrieved 31 May 2012. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!