Overview

Comprehensive Description

General comments

This information is based an ongoing project dedicated to the inventory and dissemination of information on lepidopteran larvae, their host plants, and their parasitoids in a Costa Rican tropical wet forest and an Ecuadorian montane cloud forest.


N=21 rearings as of 2012, 20 eclosed and 1 died.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General comments

N=21 rearings as of 2012, 19 eclosed and 2 died.

7-10 days as pupae (N=15).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Collected from several locations in Heredia Province, Costa Rica.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Collected in Heredia Province, Costa Rica.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Foodplant Associations

Dichapetalaceae: Dichapetalum stipulatum

Moraceae: Ficus insipida

Euphorbiaceae: Adelia triloba

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Foodplant Associations

Euphorbiaceae: Adelia triloba

Moraceae: Ficus insidida

Dichapetalaceae: Dichapetalum stipulatum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myscelia cyaniris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATACTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACATCTCTTAGTTTACTAATTCGAACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATCCCTTTAATATTAGGAGCTCCTGATATGGCTTTCCCACGAATAAATAATATAAGTTTTTGACTACTCCCCCCCTCACTAACTTTATTAATTTCAAGTAGAATCGTTGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCCCCTCTCTCTTCAAATATTGCTCATGGAGGTTCATCAGTAGACTTAGCTATTTTCTCCTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCTTTATTACTTCTCCTATCTTTACCTGTATTAGCTGGAGCTATCACTATACTTTTAACAGATCGAAATATTAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myscelia cyaniris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Myscelia cyaniris

The Blue Wave, Blue-banded Purplewing, Tropical Blue Wave, Whitened Bluewing, or Royal Blue (Myscelia cyaniris) is a butterfly of the Nymphalidae family.

Description[edit]

The length of the forewings reaches about 34–36 millimetres (1.3–1.4 in). The dorsal sides of the upperwings are bright blue with white transversal bands and white spots. The sapphire blue of the upper wings may appear black or neon blue depending on how the light is reflected. The under sides of the hind wings have a cryptic coloration as they are mottled with different shades of color, varying from gray to brown, while the under sides of the fore wings are black with white patches. The larvae feed on Dalechampia triphylla and Adelia triloba (Euphorbiaceae family). Adults usually feed on rotting fruit and animal dung.

Distribution[edit]

It is found in Central America and northern South America, from Mexico to Honduras, Costa Rica, Panama, Venezuela, Ecuador, and Peru.

Habitat[edit]

It is found from sea level to 700 m (2,300 ft) on the Atlantic slopes and is associated with rain forest habitats.[2]

Gallery[edit]

Subspecies[edit]

References[edit]

  1. ^ Myscelia, Site of Markku Savela
  2. ^ Species info
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!