Overview

Brief Summary

North American Ecology (US and Canada)

Limenitis archippus is resident to all of the eastern United States and southern Canada, west to British Columbia and WA, is patchily distributed in the southwestern US, and ranges to southern Mexico (Scott 1986). Habitats are subtropical to Canadian zone watercourses and deciduous woodlands. Host plants are trees species from families Salicaceae, Betulaceae and Rosaceae. Eggs are laid on the host plant singly. Individuals overwinter as third instar larvae in a rolled leaf hibernaculum. There is a variable number of flights depending on latitude, in the far north of the range there is one flight with approximate times June 10-July31, in the south there are four or more flights from spring to fall (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

The Viceroy is well-known for its mimetic resemblance to the Monarch (Danaus plexippus). The black median line across the hindwing is the quickest way to distinguish it from the Monarch. These two species can even be separated on the wing by their distinctive flight: Monarchs have a leisurely, floating flight and hold their wings at an angle above the body when gliding, while Viceroys hold their wings in a flat plane when gliding, a behaviour characteristic of the genus Limenitis.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Great Slave Lake, NWT east to Nova Scotia, south to Florida and Mexico (Layberry et al. 1998, Scott 1986). Extirpated from southern BC (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Southerb Canada; US except for Pacific coast and higher Rocky Mountains.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The viceroy ranges from central Canada through the eastern United States, into the Cascade Mountains and northern Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

In areas of the viceroy's range where monarchs are common, the viceroy tends to mimic the pattern of the monarch (Danaaus plexippus) with black striping and orange areas similar to a monarch. The viceroy can be distinguished from the monarch, however, by one row of white spots within the black fore and hind wing bands. In areas inhabited by the Queen (Danaus glippus), the white spotting of the viceroy becomes less noticeable, and the orange coloration is replaced by a deep mahogany brown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Usually found in open, moist areas where willows grow.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eastward almost any habitat with willows or small aspens which are the main larval foodplants. Habitats include prairies and dry barrens with small willows as well as wetlands. Westward more riparian and only around seeps or watercourses in arid regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Viceroys prefer open or slightly shrubby areas that are wet or near water. These include wet meadows, marshes, ponds and lakes, railroad tracks, and roadsides.

Terrestrial Biomes: forest ; mountains

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

No Alberta data available, but larvae are known to feed on willows and poplars (Salix and Populus) elsewhere (Layberry et al. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Larvae of all subspecies are virtually resitricted to willows (Salix) an dpoplars (including aspens) (Populus).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Larvae feed on various types of willows and poplars. Viceroys produce three generations per year, and the food habits of each generation differs. The first brood consume carrion, decaying fungi, and animal dung. Later generations are more often observed at flowers of plants, such as joe-pye weed, aster, Canada thistle, shepherd's needle, and goldenrod. This difference is likely due to the colder, wetter conditions experienced by the first generation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Limenitis archippus in Illinois

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Adults eat flower nectar, aphid honeydew, moisture from rotting wood, fungi, dung, mud, sap and other sources. Males both perch and patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

One brood per year, peak emergence in early to late July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: In most of the range two to four broods, the first in late spring (usualy May or June) the others following at about two month intervals but with stragglers often flying essentially all summer. Third instar larvae overwinter in shelters on the foodplant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The eggs are initially pale yellow, turning greyish as they mature. Fully-grown larvae are olive-brown with a pink-white saddle, and resemble a bird dropping. The thorax bears two black, horn-like spines (Scott 1986). Third-instar larvae hibernate in a hibernaculum, a tube-like shelter made of a partially rolled-up leaf and silk. It was initially believed that the Monarch-Viceroy resemblance was a case of Batesian mimicry, ie. the palatable Viceroy mimicking distasteful Monarchs. Recent research suggests that this is not the case, since Viceroys are also distasteful, so the two species are actually Mullerian mimics (Ritland and Brower 1991).  
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History

Viceroy larvae resemble bird droppings. Left image © 2005 Kimberly Rama Fleming. Right image © 2006 Brad Smith

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating occurs in the afternoon, and the female is the egg carrier. She deposits one egg onto the tip of a leaf and chooses only leaves that have not been eaten by other insects. She deposits about three eggs per sapling.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limenitis archippus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCAAGTAGAATTGTTGAAAATGGAGCCGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAACATTGCTCACAGAGGATCATCTGTTGACTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATGGTATATCATTTGATCAAATATCTTTATTTATTTGATCTGTTGGTATTACTGCTCTTTTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGTAATTTAAATACCTCATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATCTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCAGGATTTGGTATAATTTCTCATATAATTTCTCAAGAAAGAGGTAAAAAGGAAACTTTTGGTTACTTAGGAATAATTTATGCTATAATAGCAATTGGTCTACTTGGATTTATTGTATGAGCTCATCATATATTTACAGTAGGAATAGACATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Limenitis archippus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern. Extirpated in BC (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and common; adapts to some disturbance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The viceroy has a wide range and is not threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Viceroy (butterfly)

The Viceroy (Limenitis archippus) is a North American butterfly that ranges through most of the contiguous United States as well as parts of Canada and Mexico. The westernmost portion of its range extends from the Northwest Territories along the eastern edges of the Cascade Range and Sierra Nevada mountains, southwards into central Mexico. Its easternmost range extends along the Atlantic and Gulf Coasts of North America from Nova Scotia into Texas.[1]

Description[edit]

Its wings feature an orange and black pattern, and over most of its range it is a Müllerian mimic[2] with the Monarch butterfly (Danaus plexippus). The viceroy's wingspan is between 53 and 81 mm.[3] It can be distinguished from the Monarch by its smaller size and the postmedian black line that runs across the veins on the hindwing.[3]

In Florida, Georgia, and the Southwest, Viceroys share the pattern of the Queen (Danaus gilippus) and in Mexico they share the pattern of the Soldier (Danaus eresimus). In all three areas, the local Danaus population mimic the coloration of the Viceroy species. It was originally believed that the Viceroy was a Batesian mimic of the three other species, and presumed edible or only mildly unpalatable to predators, but this has since proven not to be true.[2]

Food sources[edit]

The caterpillar feeds on trees in the willow family Salicaceae, including willows (Salix), and poplars and cottonwoods (Populus). The caterpillars sequester the salicylic acid in their bodies, which makes them bitter, and upsets predators' stomachs. As further protection, the caterpillars, as well as their chrysalis stage, resemble bird droppings.

Adults are strictly diurnal, flying preferentially in the late morning and early afternoon.[4]

The Viceroy was named the state butterfly of Kentucky in 1990.[5]

Life stages[edit]

Evolution of admiral butterflies (Limenitis)[edit]

The world is divided into eight biogeographic areas called ecozones: Palearctic, Nearctic, Afrotropic, Neotropic, Australasia, Indo-Malaya, Oceania, and Antarctica. Palearctic includes most of Eurasia and North Africa while Nearctic includes most of North America. Limenitis butterfly wing patterns are much more diverse in the Nearctic than the Palearctic. Three lineages of mimetic butterflies occur in North America and the evolution of mimicry may have played a large role in the diversification of this group.[6] For butterflies to travel from the Palearctic region to the Nearctic region of the world, the migration must have occurred during a time period when Beringia, the land bridge between Eurasia and North America, was still above water.[7] Based on crude divergence rate calculations,[8] the colonization of the Nearctic Leminitis dates back approximately four million years.[6] Whether the migration event was a single or multiple occurrence event has a significant effect on how we look at the evolution of mimicry. A history of multiple migrations would suggest that speciation occurred before the evolution of mimicry, meaning mimicry was the result of speciation instead of the driver of speciation.

However, much evidence supports that a single event colonization is the best explanation. One theory of Nearctic colonization states that the reason for the colonization was a larvae host plant shift. The position of the Poplar admiral (L. populi), a Palearctic species, in a phylogenetic tree confirms that the Poplar is the closest existing relative of the Nearctic taxa and is consistent with the theory that the host plant had a large effect on the evolution of North American admirals. Just like the wing-pattern of the Palearctic butterflies has little evidence of divergence, the host plant use of these species also shows no sign of divergence. These species only feed on different species of honeysuckle (Lonicera ssp.) The exception is the Poplar that feeds exclusively on aspen (Populus tremulus of the willow family).[6] All North American Limenitis feed on members of the willow family as well, suggesting that an (ancestral host plant shift) expansion of a novel host plant across the Bering land bridge could have driven the colonization of the Nearctic. Species level phylogenies based on the mitochondrial gene COI and the gene EFI-α of Nearctic and Palearctic species also indicate a single colonization of the Nearctic species.[6] The phylogenies produced indicate that a white-banded ancestor similar to the species L. arthemis.[9] established itself in North America and resulted in several major lineages, three of which involved mimicry independently of each other. Given the present monophyly of the Nearctic species, it is likely that a single migration and subsequent expansion of the population was the foundation of the Nearctic butterflies.

Predators and avoidance[edit]

The Viceroy’s main predators – like many other butterflies – consist mostly of birds.

Mimicry as defense[edit]

The Viceroy’s major defense against predators is purported to be mimicry. It had been long accepted that the Viceroy practiced Batesian mimicry, with the Monarch and the Queen serving as models. Batesian mimicry is a type of defensive behavior in which a palatable species closely resembles unpalatable or toxic species to avoid predation. As such, the Viceroy wing color ranges from tawny orange (resembling Monarchs) in the north to dark mahogany (resembling Queens) in the south.[10]

Early experiments suggested that the Viceroy use Batesian mimicry to defend themselves against predators. Birds that had not been exposed to Monarchs willingly ate Viceroy, but those who had tasted the unpalatable Monarch refused to touch the mimic.[11] In addition, when given the choice between a mimic and non-mimic after being exposed to an unpalatable model, avian predators never ate the Viceroy mimic.[12]

It has been argued that selective pressures from predators have given rise to “model switching”[10] in the Viceroy, with each subspecies choosing to copy the color pattern of the locally dominant Danaine subspecies. When the Monarch’s breeding range overlaps with the Viceroy, the Viceroy will adopt the lighter shades of orange. Towards the south, the Viceroy mostly displayed darker orange phenotypes in response to the larger population of Queens. It is important to note that the difference between these two morphs is only the color of the wings; other features, such as body size and wing-pattern elements, are identical.[10]

Dispute[edit]

Recent research has argued that the Viceroy may be unpalatable to avian predators. If that is the case, then the Viceroy butterfly displays Müllerian mimicry, and both Viceroy and Monarch are co-mimics of each other.[13]

Some literature suggests that the Queen-Viceroy may not be a good model-mimic pair for Batesian mimicry. Experimental evidence has shown that avian predators express aversion to the Queen butterfly after being exposed to Viceroy.[14] That the avian predators avoided the Queen butterfly implies that the Queen does not serve as a model and the Viceroy as a parasitic mimic; rather, they may be Müllerian co-mimics.[14]

When avian predators were exposed to butterfly abdomen without the wings, many avian predators rejected the Viceroy after a single peck. Furthermore, they exhibited distress behavior similar to that displayed when eating other, known unpalatable species.[13]

Interestingly, when palatability was measured by looking at avian responses to butterfly abdomen, it was found that the Viceroy butterfly was significantly more unpalatable than the Queen.[13] The Queen/Viceroy relationship is too asymmetrical for them to be considered real co-mimics of each other. Instead, mathematical models have suggested that the Queen enjoys the benefits of mimicry at the Viceroy’s expense, and that the model-mimic dynamic between the two should be switched.[13]

In light of this new interpretation, it has been speculated that different food plants in different geographical locations influence the palatability of Viceroy.[14] Further investigation is needed to clarify the relationship between the Viceroy and its purported models.

Evolution of Viceroy mimicry[edit]

Based on phylogenic evidence we know that mimicry in the North American admirals was a driver of speciation. An essential condition for the evolution of mimicry was the presence and abundance of unpalatable models. Mimetic evolution also involved direct selection with the model acting as a “starting block” for the mimic to evolve against.[15] The drive behind this type of evolution must be predation. Eventually, the mimetic population undergoes phenotypic fixation, usually at a point where the wing pattern and colors of the mimic have reached the closest superficial resemblance of its model.[15] As these processes continued, the subspecies divergences began occurring as the mimetic species expanded their geographical range and began mimicking other species of butterfly.

Determining what part of the butterfly genome controls wing color and pattern is also a major component that must be taken into account when trying to understand the evolution of mimicry. Each individual stripe or spot on a wing has a distinct identity that can be traced from species to species within a family.[16] A fascinating feature of pattern genetics is that the dramatic phenotypic changes are primarily due to small changes in the gene that determines the sizes and positions of pattern elements.[16] This discovery is in accord with the principal theory for the evolution of mimicry. The theory proposes that initial mimicry is achieved by a single mutation that has a large effect on the phenotype, which immediately gives the organism some protection, and is then refined by so-called modifier genes with lesser phenotypic effects.[16] Consequently, if the genes for wing pattern and color were normal functioning genes, a single mating would produce several phenyotypically different offspring, making the ability for mimicry to evolve very difficult.

This unique puzzle led to proposal of a possible supergene. A supergene is a tight cluster of loci that facilitate the co-segregation of adaptive variation, providing integrated control of complex adaptive phenotypes.[17] Different genomic rearrangements have tightened the genetic linkage between different color and pattern loci with complete suppression of recombination in experimental crosses in a 400,000 base section containing at least 18 genes.[17] This single supergene locus controls differences in a complex phenotype like wing coloration that can involve modifications of wing pattern, shape, and body color. Mimetic patterns have high fitness correlated to locally abundant wing patterns and low fitness when the offspring have recombinant, non-mimetic phenotypes.[17] This tight-linked area of wing pattern genes explains how mimetic phenotypes are not broken up during recombination during sexual reproduction.

References[edit]

  1. ^ http://www.gardenswithwings.com/butterfly/Viceroy/index.html
  2. ^ a b Ritland, David B.; Lincoln P. Brower (11 April 1991). "The viceroy butterfly is not a batesian mimic" (abstract). Nature 350 (6318): 497–498. doi:10.1038/350497a0. Retrieved 2008-03-29. 
  3. ^ a b http://www.cbif.gc.ca/spp_pages/butterflies/species/Viceroy_e.php
  4. ^ Fullard, James H.; Nadia Napoleone (August 2001). "Diel flight periodicity and the evolution of auditory defences in the Macrolepidoptera" (PDF). Animal Behaviour 62 (2): 349–368. doi:10.1006/anbe.2001.1753. 
  5. ^ Kentucky State Butterfly, eReferenceDesk
  6. ^ a b c d Mullen S P. (2006). Wing pattern evolution and the origins of mimicry among North American admiral butterflies (Nymphalide: Limenitis). Molecular Phylogenetics and Evolution 39:747-758.
  7. ^ Prudic K L, Oliver J C. (2008). Once a Batesian mimic, not always a Batesian mimic: Mimic reverts back to ancestral phenotype when the model is absent. Proceedings of The Royal Society 275:1125-1132.
  8. ^ Brower, A V Z. (1994). Phylogeny of Heliconius butterflies inferred from mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 3:159-174.
  9. ^ Mullen S P, Dopman E B, Harrison R G. (2008). Hybrid zone origins, species boundaries, and the evolution of wing-pattern diversity in a polytypic species complex of North American butterflies (Nymphalidae: Limenitis). Evolution 62:1400-1417.
  10. ^ a b c Ritland, David (1-20). "Mimicry-related Predation on Two Viceroy Butterfly (Limenitis archippus) Phenotypes". The American Midland Naturalist 1. 
  11. ^ van Zandt Brower, Jane (March 1958). "Experimental Studies of Mimicry in Some North American Butterflies: Part I. The Monarch, Danaus plexippus, and Viceroy, Limenitis archippus archippus". Evolution 12: 32–47. doi:10.2307/2405902. Retrieved 18 September 2013. 
  12. ^ Platt, Austin P.; Raymond P. Coppinger; Lincoln P. Brower (December 1971). "Demonstration of the Selective Advantage of Mimetic Limenitis Butterflies Presented to Caged Avian Predators". Evolution 25 (4): 692–701. doi:10.2307/2406950. Retrieved 18 September 2013. 
  13. ^ a b c d Ritland, David B. (August 1995). "Comparative unpalatability of mimetic viceroy butterflies (Limenitis archippus) from four south-eastern United States populations". Oecologia 103 (3): 327–336. doi:10.1007/bf00328621. 
  14. ^ a b c Ritland, David B. (June 1991). "Revising a Classic Butterfly Mimicry Scenario: Demonstration of Müllerian Mimicry between Florida Viceroys (Limenitis archippus floridensis) and Queens (Danaus gilippus berenice)". Evolution 45 (4): 918–934. doi:10.2307/2409699. 
  15. ^ a b Platt A P. 1983. Evolution of North American admiral butterflies. Bulletin of the Entomological Society of America 29: 11-22.
  16. ^ a b c Nijhout H F. 1994. Developmental perspectives on evolution of butterfly mimicry. Bioscience 44: 148-157.
  17. ^ a b c Joron M, Frezal L, Jones R, Chamberlain N, Lee S, Haag C, Whibley A, Becuwe M, Baxter S, Ferguson L, Wilkinson P, Salazar C, Davidson C, Clark R, Quail M, Beasley H, Glithero R, Lloyd C, Sims S, Jones M, Rogers J, Jiggins C, Constant R. 2011. Chromosomal rearrangements maintain a polymorphic supergene controlling butterfly mimicry. Nature 477: 203-207.

Further reading[edit]

  • Glassberg, Jeffrey Butterflies through Binoculars, The West (2001)
  • Guppy, Crispin S. and Shepard, Jon H. Butterflies of British Columbia (2001)
  • James, David G. and Nunnallee, David Life Histories of Cascadia Butterflies (2011)
  • Pelham, Jonathan Catalogue of the Butterflies of the United States and Canada (2008)
  • Pyle, Robert Michael The Butterflies of Cascadia (2002)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: A widespread species with some geographical and much individual variation. Two subspecies are almost universally recognized: FLORIDENSIS (mainly Florida) and OBSOLETA (southwestern USA and adjacent Mexico). Subspecies LAHONTANI (Nevada) is more or less transitional to OBSOLETA. Subspecies IDAHO needs to be reevaluated. It is close to typical ARCHIPPUS but probably shows some tendancy towards LAHONTANI. Based on the illustrations in its description and examination of additional published illustrations and specimens of eastern viceroys, dorsally IDAHO seems to fall mostly within the range of variation of northern transcontinental viceroys but the ventral tan areas are paler than at least eastern populations (D. Schweitzer).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!