Overview

Brief Summary

North American Ecology (US and Canada)

Phyciodes campestris is native to western North America from Alaska through California, and as far east as Texas (Scott 1986). Habitats are plains to mountains and Taiga. Host plants are herbaceous, and restricted to one family, Compositae. Eggs are laid on the host plant in large clusters. Individuals overwinter as half-grown larvae. There is one flight each year late June ? early Aug in the far north and in high mountains and 3-4 flights each year in the more southern part of their range (April1-Oct. 31 in lowland Calif.; May1-Sept30 in Colorado plains (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

Our darkest crescent, the upperside is mostly brown-black unlike the others. The median line on the dorsal forewing is always thick and black, not broken with orange. Occurs only in the foothills and mountain region. Other names that have been applied to this species include campestris (Behr) and pulchellus (= pulchella) (Boisduval); see Scott (1994) and Layberry et al. (1998) for discussion on name usage. Our populations are susbspecies owimba (Scott 1998).  
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The field crescent butterfly spans the shores of the Arctic Ocean from Canada south to Mexico. This species is most commonly spotted flying at low to middle altitudes in the Rocky Mountains, and in higher mountains of the Northwest United States. Phyciodes campestris occupies central Alaska, the Mackenzie District of the Northwest and Saskatchewan territories in Canada, California, Arizona, New Mexico, as well as the western edge of the Great Plains.

Biogeographic Regions: nearctic (Native )

  • Scott, J. 1986. The Butterflies of North America: A Natural History and Field Guide. Stanford, CA: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A western mountain species, found from Alaska south to Mexico (Scott 1986).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) North America west of the Great Plains, from Alaska to Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The field crescent butterfly spans the shores of the Arctic Ocean from Canada south to Mexico. This species is most commonly spotted flying at low to middle altitudes in the Rocky Mountains, and in higher mountains of the Northwest United States. Phyciodes_campestris occupies central Alaska, the Mackenzie District of the Northwest and Saskatchewan territories in Canada, California, Arizona, New Mexico, as well as the western edge of the Great Plains.

Biogeographic Regions: nearctic (Native )

  • Scott, J. 1986. The Butterflies of North America: A Natural History and Field Guide. Stanford, CA: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The field crescent butterfly is generally quite small with a wingspan of 1 -1.5 inches (2.5-4.5 cm). The wings on the upper side are orange and brown with black margins, spots, and lines, while the underside of the wings reproduce these same spots in paler tints. The under side of the forewing is yellow-brown with a yellow arch at the cell, and the under side of the hindwing is yellow-brown with rusty markings. Of the spots on the underside of the wing, the most characteristic of Phyciodes campestris is the pale crescent situated on the outer margin of the hind wing. This spot is frequently pearly-white or silver colored.

Eggs are a pale-yellow-green, and are always longer than broad, with the surface at the base more or less pitted giving them a thimble-like appearance.

Phyciodes campestris larvae are patterned a darker, blackish brown with black heads. Weak cream dorsal strips and a lighter crescent strip adorn the body and eyes. They have tubercles arranged in regular rows.

The chrysalis, a protective structure during pupation, is a light mottled grey to brown, pendant shaped, and has small bumps along the dorsal region of the abdomen.

Range wingspan: 2.5 to 4.5 mm.

Other Physical Features: ectothermic ; bilateral symmetry

  • Douglas, M. 1986. The Lives of Butterflies. Ann Arbor, MI: The University of Michigan Press.
  • Holland, W. 1907. The Butterfly Book. New York. NY: Doubleday, Page, and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The field crescent butterfly is generally quite small with a wingspan of 1 -1.5 inches (2.5-4.5 cm). The wings on the upper side are orange and brown with black margins, spots, and lines, while the underside of the wings reproduce these same spots in paler tints. The under side of the forewing is yellow-brown with a yellow arch at the cell, and the under side of the hindwing is yellow-brown with rusty markings. Of the spots on the underside of the wing, the most characteristic of Phyciodes_campestris is the pale crescent situated on the outer margin of the hind wing. This spot is frequently pearly-white or silver colored.

Eggs are a pale-yellow-green, and are always longer than broad, with the surface at the base more or less pitted giving them a thimble-like appearance.

Phyciodes_campestris larvae are patterned a darker, blackish brown with black heads. Weak cream dorsal strips and a lighter crescent strip adorn the body and eyes. They have tubercles arranged in regular rows.

The chrysalis, a protective structure during pupation, is a light mottled grey to brown, pendant shaped, and has small bumps along the dorsal region of the abdomen.

Range wingspan: 2.5 to 4.5 mm.

  • Douglas, M. 1986. The Lives of Butterflies. Ann Arbor, MI: The University of Michigan Press.
  • Holland, W. 1907. The Butterfly Book. New York. NY: Doubleday, Page, and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

This species lives in flat open areas such as fields, meadows, forest clearings, grassland valleys, and swamps. The field crescent also dwells along canals and streamsides. In the northern part of the geographic range, Phyciodes campestris can be found almost anywhere, from plains to mountains, as well as in taiga -a broad subarctic band where the winters are long and cold. In the far northwestern part of its range, the habitat changes into arctic-alpine meadows, and fell-fields.

Habitat Regions: temperate

Terrestrial Biomes: taiga ; savanna or grassland ; scrub forest ; mountains

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clearings and meadows of the mountain and foothills region.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: A variety of open areas including prairies, fields, woodland glades, often riparian. Hosts are in genera Aster (incl. A. foliaceus), Machaeranthera.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species lives in flat open areas such as fields, meadows, forest clearings, grassland valleys, and swamps. The field crescent also dwells along canals and streamsides. In the northern part of the geographic range, Phyciodes_campestris can be found almost anywhere, from plains to mountains, as well as in taiga -a broad subarctic band where the winters are long and cold. In the far northwestern part of its range, the habitat changes into arctic-alpine meadows, and fell-fields.

Habitat Regions: temperate

Terrestrial Biomes: taiga ; savanna or grassland ; scrub forest ; mountains

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Phyciodes campestris larvae feed communally until half grown and then again during winter months. Caterpillars feed on various asters (Aster and Machaeranthera species) throughout their development. As the field crescent matures into an adult, flower nectar -a solution of sugars, water, and occasional amino acids, becomes the primary source of nourishment.

Plant Foods: leaves; nectar

Primary Diet: herbivore (Folivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adults nectar at a variety of composites (Asteraceae), particularly asters and ragwort (Bird et al. 1995). In BC and the US, larvae feed on the leaves of asters (Aster spp.) (Scott 1994, Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Phyciodes_campestris larvae feed communally until half grown and then again during winter months. Caterpillars feed on various asters (Aster and Machaeranthera species) throughout their development. As the field crescent matures into an adult, flower nectar -a solution of sugars, water, and occasional amino acids, becomes the primary source of nourishment.

Plant Foods: leaves; nectar

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

One yearly flight, generally peaking in July, dedpending on elevation and snowpack.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The pale green eggs are laid in clusters on leaf undersides. Larvae are brown with spines and black stripes, and overwinter in the fourth instar (Scott 1994).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males patrol just above the meadows during the day in search for females. After mating,females slowly flutter through the vegetation looking for a place to lay their eggs.

The eggs are a pale-yellow-green, laid singly in large clusters on the underside of host leaves, especially on young plants.

Key Reproductive Features: sexual ; fertilization (Internal ); oviparous

After eggs are layed on a suitable host plant, there is no further parental investment.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

  • Douglas, M. 1986. The Lives of Butterflies. Ann Arbor, MI: The University of Michigan Press.
  • Holland, W. 1907. The Butterfly Book. New York. NY: Doubleday, Page, and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males patrol just above the meadows during the day in search for females. After mating,females slowly flutter through the vegetation looking for a place to lay their eggs.

The eggs are a pale-yellow-green, laid singly in large clusters on the underside of host leaves, especially on young plants.

Key Reproductive Features: sexual ; fertilization (Internal ); oviparous

After eggs are layed on a suitable host plant, there is no further parental investment.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

  • Douglas, M. 1986. The Lives of Butterflies. Ann Arbor, MI: The University of Michigan Press.
  • Holland, W. 1907. The Butterfly Book. New York. NY: Doubleday, Page, and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phyciodes pulchella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGAACTGAATTAGGAAATCCCGGATCTTTAATTGGAGAT---GATCAAATTTATAACACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATGTTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTACTACCCCCATCACTAATTTTATTAATTTCTAGTAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTNTACCCACCCCTCTCATCTAATATTGCCCATAGAGGAGCTTCAGTAGACTTAGCAATTTTTTCCCTTCATTTAGCGGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTGTTAATAATATATCTTTTGATCAAATACCTTTATTCGTTTGAGCTGTCGGTATCACAGCTTTATTACTATTACTTTCATTACCAGTATTAGCTGGTGCTATTACAATACTTTTAACTGATCGAAATATTAATACTACATNTTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACACTTATTTTGATTTTTTGGTNNNNNNNAAGTATATATTCTTATTTTACCGGGATTTGGAATAATCTCTCATATTATTTCTCAAGAAAGAGGAAAAAAGGAAACTTTTGGTTGTTTAGGTATAATTTATGCTATAATAGCAATTGGTCTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGTATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phyciodes pulchella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 105
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phyciodes pratensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: One of most abundant western NA species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Need to check status of Sacramento-San Joaquin delta populations in California (See Art Shapiro, UC Davis).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Phyciodes pulchella

The Field Crescent (Phyciodes pulchella) is a butterfly of the Nymphalidae family. It is found in the Nearctic ecozone.

The wingspan is 24–36 mm. The butterfly flies from May to August in Canada.[1]

The larvae feed on Asteraceae species.[1]

Subspecies[edit]

Listed alphabetically.[2]

  • P. p. camillus Edwards, 1871
  • P. p. deltarufa Scott, 1998
  • P. p. inornatus Austin, 1998
  • P. p. montana (Behr, 1863)
  • P. p. owimba Scott, 1998
  • P. p. pulchella
  • P. p. tutchone Scott, 1994
  • P. p. shoshoni Scott, 1994
  • P. p. vallis Austin, 1998

Similar species[edit]

References[edit]

  1. ^ a b Field Crescent, Butterflies of Canada
  2. ^ Phyciodes, funet.fi
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Opler and Warren (2002) state, "Lectotype designation of pulchella by Emmel et al. (1998) displaces pratensis (Behr, 1863)." The use of pulchella over campestris and pratensis follows Scott (1994), though it is disputed by some (e.g. Layberry et al., 1998). According to Pelham (2008), a petition to the I.C.Z.N. may be needed to resolve the matter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!