Overview

Brief Summary

North American Ecology (US and Canada)

Phyciodes tharos is resident in the eastern and southern United States, as far north as Alberta and south to southern Mexico and Bimini (Scott 1986). Habitats are moist meadows, moist fields, moist prairie and streamsides. Host plants are herbaceous and largely restricted to one genus, Aster (Compositae). Eggs are laid on the host plant in clusters with between 20-300 (average 63) eggs per clutch. Individuals overwinter as X. There is a variable number of flights each year depending on latitude with multiple flights all year in the south, and two flights in the far northern part of the range with approximate flight times late May-Aug30 (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

General Description

The crescents form a complex group of poorly understood species, partly as a result of the fact that they are often very similar in appearance. Extensive genetic research by Wahlberg et al. (2003) has not clarified the species relationships. Males of the Pearl Crescent have more extensive upperside black markings (the black forewing median line is usually continuous not broken) comapred to the Northern Crescent (P. cocyta), and the hindwing marginal pale yellow crescents are more prominent, resulting in a broken rather than a solid black margin. Compared to batesii, tharos has less black on the upperside, and the tip of the antennal club is black, white and orange, not black and white as in batesii. This character is not relaible for separating females of these species. Tharos females generally have a more distinclty marked underside than either cocyta or batesii females. Female crescents have more black markings on the upperside and paler orange spots in addition to the orange ground colour; they are best identified by association with males from the same population. Subspecies orantain, recently named by Scott (1998), describes our populations.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Occurs throughout eastern North America, north to southern Ontario and southern Alberta (Scott 1986).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Eastern United States, extending north to southern New England and Wisconsin, and west to Colorado. Also occurs south to central Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The pearl crescent butterfly ranges from Alberta, Canada down south along the east coast of the United States into Mexico. It has also been seen in Montana, Wyoming, Colorado, New Mexico, Arizona, southeastern California, and Mexico. This species is not found in the Pacific Northwest.

Biogeographic Regions: nearctic (Native )

  • Klots, A. 1951. Field Guide to Butterflies of North America, East of the Great Plains. Boston: Houghton Mifflin Co..
  • Scott, J. 1986. The Butterflies of North America. Standford, California: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The pearl crescent butterfly ranges from Alberta, Canada down south along the east coast of the United States into Mexico. It has also been seen in Montana, Wyoming, Colorado, New Mexico, Arizona, southeastern California, and Mexico. This species is not found in the Pacific Northwest.

Biogeographic Regions: nearctic (Native )

  • Klots, A. 1951. Field Guide to Butterflies of North America, East of the Great Plains. Boston: Houghton Mifflin Co..
  • Scott, J. 1986. The Butterflies of North America. Standford, California: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Phyciodes_tharos is a small to medium sized butterfly that is 16-18 mm in length, with a wingspan of 3-4 cm. There are characteristic traits that differentiate males from females. Female wing coloration is generally darker than in males, with paler median spots. Males have black antennal knobs, which females lack altogether. The butterfly's coloration is black and vibrant orange, but the markings can vary geographically and can change from season to season. Spring butterflies tend to be darker than summer generations and have grey mottled hindwings. Typically, the upperside of the wings are brighter orange with marks on the forewings. The underside of the hindwings are an unmarked orange-brown to gray-brown, with a white cresent along the outer margin. Eggs are green. Larvae are chocolate brown, have a white mid-dorsal line, and are covered with tiny white dots. As larvae develop, caterpillars turn black and gain yellow bands on thier sides and spots along their back. The caterpillar also has eight rows of brown-yellow spines.

Range length: 16 to 18 mm.

Range wingspan: 3 to 4 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; sexes shaped differently

  • Carter, D. 1992. Eyewitness Handbook of Butterflies and Moths. New York: Dorling Kindersley, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Phyciodes tharos is a small to medium sized butterfly that is 16-18 mm in length, with a wingspan of 3-4 cm. There are characteristic traits that differentiate males from females. Female wing coloration is generally darker than in males, with paler median spots. Males have black antennal knobs, which females lack altogether. The butterfly's coloration is black and vibrant orange, but the markings can vary geographically and can change from season to season. Spring butterflies tend to be darker than summer generations and have grey mottled hindwings. Typically, the upperside of the wings are brighter orange with marks on the forewings. The underside of the hindwings are an unmarked orange-brown to gray-brown, with a white cresent along the outer margin. Eggs are green. Larvae are chocolate brown, have a white mid-dorsal line, and are covered with tiny white dots. As larvae develop, caterpillars turn black and gain yellow bands on thier sides and spots along their back. The caterpillar also has eight rows of brown-yellow spines.

Range length: 16 to 18 mm.

Range wingspan: 3 to 4 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; sexes shaped differently

  • Carter, D. 1992. Eyewitness Handbook of Butterflies and Moths. New York: Dorling Kindersley, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Grasslands and dry meadows of the prairie and parkland regions.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: A great variety of open to lightly wooded situations, wet to rather dry, most often highly disturbed but also natural communities.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The pearl crescent prefers open, moist, and sunny places. It is commonly found along roadsides, fields and meadows, open pine forests, and vacant lots.

Habitat Regions: temperate

Terrestrial Biomes: savanna or grassland ; forest

Other Habitat Features: agricultural

  • Taylor, J. 1994. Some Common Butterflies. Conservationist, March-June, 1994: 48, 5-6, 10-13.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The pearl crescent prefers open, moist, and sunny places. It is commonly found along roadsides, fields and meadows, open pine forests, and vacant lots.

Habitat Regions: temperate

Terrestrial Biomes: savanna or grassland ; forest

Other Habitat Features: agricultural

  • Taylor, J. 1994. Some Common Butterflies. Conservationist, March-June, 1994: 48, 5-6, 10-13.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

The larval hosts are not known in Alberta. Larvae feed on asters (Aster spp.) in the west-central US (Scott 1998) and also in Manitoba (Klassen et al. 1989).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The adult uses a siphoning technique to feed on nectar from an array of flowers including dogbane, swamp milkweed, shepherd's needle, asters, black-eyed susans, thistle, gloriosa daisies, white clover, and winter cress. The butterfly siphons nectar out of the flower by using its coiled tongue (proboscis). Caterpillars have chewing mouthparts used to eat leaves and other materials off of plants.

Plant Foods: leaves; nectar; flowers

  • Pyle, R. 1984. Audubon Society for Butterfly Watchers. New York: Charles Scribner's Sons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The adult uses a siphoning technique to feed on nectar from an array of flowers including dogbane, swamp milkweed, shepherd's needle, asters, black-eyed susans, thistle, gloriosa daisies, white clover, and winter cress. The butterfly siphons nectar out of the flower by using its coiled tongue (proboscis). Caterpillars have chewing mouthparts used to eat leaves and other materials off of plants.

Plant Foods: leaves; nectar; flowers

Primary Diet: herbivore (Folivore , Nectarivore )

  • Pyle, R. 1984. Audubon Society for Butterfly Watchers. New York: Charles Scribner's Sons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Phyciodes tharos in Illinois

Phyciodes tharos Drury: Nymphalidae, Lepidoptera
(observations are from Robertson, Graenicher, Reed, Clinebell, Willson & Bertin, Fothergill & Vaughn; this butterfly is the Pearl Crescent)

Alismataceae: Sagittaria latifolia [stam sn] [pist sn] (Rb); Apiacae: Cicuta maculata sn (Rb), Eryngium yuccifolium sn (Rb), Heracleum maximum sn (Rb), Zizia aurea sn (Rb); Asclepiadaceae: Asclepias incarnata [plab sn] (Rb), Asclepias perennis [plup sn] (FV), Asclepias sullivanti [plab sn] (Rb), Asclepias tuberosa [plab sn] (Rb), Asclepias verticillata [plab sn] [plup sn] (Rb, WB); Asteraceae: Achillea millefolium sn (Re), Ageratina altissima sn (Gr), Aster anomalus sn (Rb), Aster furcatus sn (Gr), Aster lanceolatus sn (Rb), Aster novae-angliae sn (Rb, Gr), Aster pilosus sn fq (Rb), Aster puniceus sn (Gr), Aster turbinellus sn (Rb), Bidens aristosa sn (Rb), Bidens cernua sn (Rb), Bidens discoidea sn (FV), Boltonia asterioides sn (Rb), Cirsium vulgare sn (Rb), Conoclinium coelestinum sn (Rb), Coreopsis palmata sn (Rb), Coreopsis tripteris sn (Rb), Erigeron philadelphicus sn (Rb, FV), Eupatoriadelphus purpureus sn (Gr), Eupatorium altissimum sn (Rb), Eupatorium perfoliatum sn (Rb), Eupatorium serotinum sn (Rb), Euthamia graminifolia sn (Rb), Helenium autumnale sn (Rb), Helianthus mollis sn (Rb), Helianthus pauciflorus sn (Rb), Helianthus strumosus sn (Gr), Helianthus tuberosus sn (Rb), Heliopsis helianthoides sn (Rb, Gr), Krigia biflora sn (Rb), Pluchea camphorata sn (FV), Pseudognaphalium obtusifolium sn (Rb), Ratibida pinnata sn (Rb), Rudbeckia hirta sn (Gr), Rudbeckia laciniata sn (Gr), Rudbeckia subtomentosa sn fq (Rb), Rudbeckia triloba sn fq (Rb), Solidago canadensis sn (Gr), Solidago gigantea sn (FV), Verbesina helianthoides sn (Rb); Boraginaceae: Lithospermum canescens sn (Rb); Brassicaceae: Capsella bursa-pastoris sn (Rb); Caprifoliaceae: Symphoricarpos albus sn (Gr), Symphoricarpos occidentalis sn (Gr); Caryophyllaceae: Cerastium nutans sn (Rb); Cornaceae: Cornus obliqua sn (Rb); Fabaceae: Trifolium repens sn (FV); Lamiaceae: Lycopus americanus sn (Rb), Monarda fistulosa sn (Cl), Nepeta cataria sn (Rb), Pycnanthemum pilosum sn (Rb), Pycnanthemum tenuifolium sn (Rb), Pycnanthemum virginianum sn fq (Rb); Liliaceae: Lilium philadelphicum sn (Gr), Tofieldia glutinosa sn (Gr); Oxalidaceae: Oxalis corniculata sn fq (Rb), Oxalis violacea sn (Rb); Polemoniaceae: Phlox pilosa sn (Rb); Polygonaceae: Persicaria hydropiperoides sn (FV), Persicaria lapathifolia sn (Rb); Portulacaceae: Claytonia virginica sn (Rb); Rosaceae: Fragaria virginiana sn (Rb), Potentilla simplex sn (Rb); Rubiaceae: Cephalanthus occidentalis sn fq (Rb); Verbenaceae: Phyla lanceolata sn fq (Rb, FV), Verbena stricta sn (Rb), Verbena urticifolia sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed on flower nectar and mud. Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Double brooded in Alberta, flying primarily in June and again in August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Scott (1998, 1994) gives detailed descriptions of the immatures. The pale green eggs are laid in clusters, and the larvae are dark brown, spiny and feed on leaf undersides. Partially grown (fourth instar) larvae hibernate (Scott 1998). Young larvae feed during the day, while older ones appear to be strictly nocturnal, resting in plant litter below the host during the day (Scott 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

As larvae develop, caterpillars turn black and gain yellow bands on thier sides and spots along their back.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

As larvae develop, caterpillars turn black and gain yellow bands on thier sides and spots along their back.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During courtship, the male pursues the female butterfly while he is patroling the host plant. If the female is flying, she lands, keeping her wings spread. Next, the male lands behind her, possibly displaying his wings and on occasion fluttering them. With his wings partially opened he crawls under her hindwings to mate. For highly receptive females, which are usually motionless, the male rarely displays or flutters before mating. On the other hand, an unreceptive female will close her wings, possibly causing the male to leave. If the male doesn't fly away, the female may raise her abdomen (so he cannot join), turn and crawl away, drop down into vegetation, or fly away to escape.

Females lay eggs in masses of 20-200 (average 36), sometimes two or three layers deep on the underside leaves of a host plant (usually aster leaves).

Range eggs per season: 20 to 200.

Average eggs per season: 36.

Key Reproductive Features: semelparous ; sexual ; fertilization (Internal ); oviparous

After oviposition, there is no further parental involvement.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

  • Carter, D. 1992. Eyewitness Handbook of Butterflies and Moths. New York: Dorling Kindersley, Inc.
  • Klots, A. 1951. Field Guide to Butterflies of North America, East of the Great Plains. Boston: Houghton Mifflin Co..
  • Scott, J. 1986. The Butterflies of North America. Standford, California: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During courtship, the male pursues the female butterfly while he is patroling the host plant. If the female is flying, she lands, keeping her wings spread. Next, the male lands behind her, possibly displaying his wings and on occasion fluttering them. With his wings partially opened he crawls under her hindwings to mate. For highly receptive females, which are usually motionless, the male rarely displays or flutters before mating. On the other hand, an unreceptive female will close her wings, possibly causing the male to leave. If the male doesn't fly away, the female may raise her abdomen (so he cannot join), turn and crawl away, drop down into vegetation, or fly away to escape.

Females lay eggs in masses of 20-200 (average 36), sometimes two or three layers deep on the underside leaves of a host plant (usually aster leaves).

Range eggs per season: 20 to 200.

Average eggs per season: 36.

Key Reproductive Features: semelparous ; sexual ; fertilization (Internal ); oviparous

After oviposition, there is no further parental involvement.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

  • Carter, D. 1992. Eyewitness Handbook of Butterflies and Moths. New York: Dorling Kindersley, Inc.
  • Klots, A. 1951. Field Guide to Butterflies of North America, East of the Great Plains. Boston: Houghton Mifflin Co..
  • Scott, J. 1986. The Butterflies of North America. Standford, California: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Phyciodes tharos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 71
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Phyciodes tharos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGAACTGAATTAGGAAATCCCGGATCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTACTACCCCCGTCATTAATTTTATTAATTTCTAGTAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCCCTTTCATCTAATATTGCCCATAGAGGAGCTTCAGTAGATTTAGCAATTTTTTCCCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTGTTAATAATATATCCTTTGATCAAATACCTTTATTCGTTTGAGCTGTCGGTATTACAGCCTTATTATTATTACTTTCATTACCAGTATTAGCTGGTGCTATTACAATACTTTTAACTGATCGAAATATTAACACTTCATTTTTTGACCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACACTTATTTTGATTTTTTGGTCACCCTGAAGTNTATATTCTTATTTTACCAGGATTTGGAATAATTTCCCATATTATTTCTCAAGAAAGAGGAAAAAAGGAAACTTTTGGTTGTTTAGGTATAATTTATGCCATAATGGCAATTGGTCTTTTAGGATTCATTGTTTGAGCTCATCATATATTTACAGTAGGTATAGATATTGATACTCGAGCCTATTTCACATCAGCAACTATAATTATTGCAGTACCAACAGGTATTAAAATTTTTAGATGATTAGCAACTCTTCATGGTACA---CAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and abundant, thrives in disturbed areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The pearl crescent butterfly is in no danger of extinction, although it may be rare in parts of its range, especially at the periphery.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The pearl crescent butterfly is in no danger of extinction, although it may be rare in parts of its range, especially at the periphery.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Comments: Often benefits from human activities, including agriculture.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This butterfly has little economic significance, although larvae can be a nuisance, eating the leaves off of their host plants.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This species of butterfly has no known economic importance.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

This butterfly has little economic significance, although larvae can be a nuisance, eating the leaves off of their host plants.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This species of butterfly has no known economic importance.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pearl Crescent

The Pearl Crescent (Phyciodes tharos) is a butterfly of North America. It is found in all parts of the United States except the west coast, and throughout Mexico and parts of southern Canada, in particular Ontario. Its habitat is open areas such as pastures, road edges, vacant lots, fields, open pine woods. Its pattern is quite variable. Males usually have black antennal knobs. Its upperside is orange with black borders; postmedian and submarginal areas are crossed by fine black marks. Underside of hindwing has a dark marginal patch containing a light-colored crescent.

The wingspan is from 21 to 34 mm.[1] The species has several broods throughout the year, from April–November in the north, and throughout the year in the Deep South and Mexico.

ventral view
Caterpillar
Composite showing the variation in this species

Adults find nectar from a great variety of flowers including dogbane, swamp milkweed, shepherd's needle, asters, and winter cress. Males patrol open areas for females. The eggs are laid in small batches on the underside of host plant leaves. Caterpillars eat the leaves and are gregarious when young. Hibernation is by third-stage caterpillars.

Similar species

References

  1. ^ Pearl Crescent, Butterflies of Canada
  • Jim P. Brock, Kenn Kaufman (2003) Butterflies of North America. Boston: Houghton Mifflin. ISBN 0-618-15312-8.
  • Jeffrey Glassberg (1999) Butterflies through Binoculars : The East A Field Guide to the Butterflies of Eastern North America. New York: Oxford University Press. ISBN 0-19-510668-7.
  • James A. Scott (1986) The Butterflies of North America: A Natural History and Field Guide. Stanford, California: Stanford University Press. ISBN 0-8047-2013-4.
  • Pearl Crescent, BugGuide.net
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!