Overview

Comprehensive Description

General Description

Similar to our other two species of true admirals (Limenitis). The White lacks the rust-coloured forewing tips of Lorquin's (L. lorquini), and has a row of reddish spots bordering the outside of the hindwing white band. Their ranges overlap only in the Waterton - Crowsnest region, where hybrid individuals exhibiting characters intermediate between the White and Lorquin's are sometimes found. L. arthemis also has more orange on the hindwing upperside than Weidemeyer's (L. weidemeyerii), and has a red-brown hindwing underside base rather than predominantly white. Hybrids between these two species sometimes also occur.  The western Canadian populations are subspecies rubrofasciata.  
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The White Admiral is found throughout the eastern United States and West into the Rocky Mountains.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alaska east to Newfoundland, south to Florida and eastern Texas. In the range roughly south of the Canadian border, this species looks very different, and is known as the Red-spotted Purple (L. arthemis astyanax).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The White Admiral has a wingspan of 60-70 millimeters. The upperside of both wings are black and there is a broad white band across each dorsal wing. On the base of the wings are orange spots and marginal rows of white and bluish dashes.

Other Physical Features: ectothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The White Admiral inhabits deciduous broad-leaf forests and mixed evergreen forests. It also prefers forest edges and clearings.

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common in shrubby and wooded areas throughout the province.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Foodplants of the White Admiral include wild cherry, poplar, aspens, and black oaks. The larval foodplant consisits of various trees such as the birch, willow, and poplar.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Larvae have been recorded primarily from poplars and willows (Salicaceae) (Layberry et al. 1998), although no particular species have been noted for Alberta. Adults are more fond of carrion and scat than flowers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

One annual brood, peak flight period from mid June to late July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The pale green eggs are round and sculptured (Guppy &Shepard 2001). Second instar larvae construct a shelter out of a partially rolled-up leaf base with silk, and hibernate inside this structure (Guppy & Shepard 2001). Mature larvae bear a remarkable resemblance to a bird dropping when resting on a leaf, since they are splotchy white and grey brown in colour (Guppy & Shepard 2001) and have a shiny look to them. There are usually five instars, but in BC, male larvae may occasionally 'fast-track' and pupate the same season after only four instars (Guppy & Shepard 2001), forming a partial second brood in late summer and early fall. This phenomenon may also account for August and September records in Alberta (Bird et al. 1995). Adult males perch in shrubs and trees, occasionally patrolling along forest edges, and fly out to investigate other butterflies passing by.  
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The White Admiral will often hybridize with the red spotted purple, another member of the genus Limenitis.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limenitis arthemis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 160 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGCGAAAATGACTTTTTTCTACAAATCATAAGGATATTGGAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCCGGATCATTAATTGGAGATGATCAAATTTATAATACTATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAATTATAATTGGAGGTTTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAACTTTACTTATTGCAAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATAGAGGATCATCTGTTGACTTAGCTATTTTTTCTTTACATTTAGCGGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAGTTAATGGGATATCATTTGATCAAATATCTTTATTTATTTGATCCGTTGGTATTACTGCTCTTTTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATACTGTTAACTGATCGTAATTTAAATACTTCATTTTTTGACCCCGCCGGAGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Limenitis arthemis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 155
Specimens with Barcodes: 207
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

White admirals are currently widespread and abundant and not listed as threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

No documented examples.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No documented examples.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Limenitis arthemis

The White Admiral or Red-spotted Purple (Limenitis arthemis) is a polytypic species of North American brush-footed butterfly, common throughout much of the eastern United States. L. a. astyanax has red spots on its underside and the top of the wings are notable for their iridescent blue markings. L. a. arthemis on the other hand has a large white band traversing both the forewings and hindwings.

Distribution map of Limenitis arthemis. The red shows the range of L. a. arthemis; the orange L. a. astyanax; the green L. a. arizonansis; and the yellow shows where the ranges of L. a arthemis and L. a. astyanax overlap.

The Red-spotted Purple is a mimic of the poisonous Pipevine Swallowtail (Battus philenor) and is typically found in open woodlands and along forest edges.

Subspecies[edit]

Four subspecies of the butterfly are known:

Description[edit]

Both sexes of this species are identical except that the females are slightly larger than the males.[2] The upper side of L. a. arthemis is mostly blackish-blue with white postmedian bands across both wings. Some individuals have a row of red submarginal spots, while others have this area being blue. The underside of the wings is a blackish color with a broad white postmedian band. The basal area of both wings contains many red spots. The submarginal area may contain a row of red spots and the marginal area having bluish spots. However, sometimes the submarginal and marginal areas are just a reddish-brown color.[2][3][4]

The upper side of L. a. astyanax is very much like L. a. arthemis except it lacks the broad white bands. The fore wing submarginal area will sometimes have a row of red spots. The hind wings are either a bright iridescent blue or an iridescent bluish-green. The underside of the wings lacks the white band. The basal area has several red spots. It has a row of red submarginal spots and bluish marginal spots.[2][3]

L. a. arizonensis is indistinguishable from L. a. astyanax except that L. a. arizonensis is found in the southwest and its range does not overlap the range of L. a. astyanax.[3][5]

Intermediates between L. a. arthemis and L. a. astyanax can occur. L. a. arthemis f. proserpina has faint white bands. L. a. arthemis f. albofaciata has more conspicuous white bands but they are not as broad as the bands are on L. a. arthemis.[2][4]

Ecology[edit]

Preferred host plants: birches, including Betula lenta; Salicaceae, including Salix bebbiana and Populus tremuloides, and Prunus virginiana (Rosaceae).

Also but not as often: Crataegus, Amelanchier, Malus pumila, Prunus pensylvanica and Prunus serotina (Rosaceae), Populus deltoides, P. grandidentata and P. balsamifera (Salicaceae), Alnus rugosa, Betula alleghaniensis and Carpinus caroliniana (Betulaceae), Ulmus americana (Ulmaceae), Tilia americana (Malvaceae) and Fagus grandifolia (Fagaceae).

Adults are diurnal, they fly from the morning until soon after dusk (Fullard & Napoleone 2001).

Etymology[edit]

Limenitis (New Latin "of harbours", from Ancient Greek Λιμενιτις (from λιμήν, a harbour, haven) - an epithet of Artemis, goddess of the hunt and the wild. arthemis, from Artemis.[6]

Image gallery[edit]

In popular culture[edit]

The poem Unconscious came a beauty by May Swenson mentions the "Red-spotted purple" (or the similar looking Mourning cloak) - a butterfly that makes her pause in her writing. The poem is also a word-picture or iconograph, where the lines are laid out to look like a butterfly.

The White Admiral (Limenitis arthemis arthemis) is, since a poll in October 1998, the (unofficial) insect emblem of the province of Quebec, Canada. (See Quebec symbols and emblems for further details). It is the only sub-species of Limenitis arthemis present in Quebec.

References[edit]

Footnotes[edit]

  1. ^ Arizona Red-spotted Purple, BugGuide
  2. ^ a b c d Rick Cech and Guy Tudor (2005). Butterflies of the East Coast. Princeton University Press, Princeton, NJ. ISBN 0-691-09055-6
  3. ^ a b c Jim P. Brock and Kenn Kaufman (2003). Butterflies of North America. Houghton Mifflin, New York, NY. ISBN 0-618-15312-8
  4. ^ a b David C. Iftner, John A. Shuey, and John V. Calhoun (1992). Butterflies and Skippers of Ohio. College of Biological Sciences and The Ohio State University. ISBN 0-86727-107-8
  5. ^ Bob Stewart, Priscilla Brodkin and Hank Brodkin (2001). Butterflies of Arizona. West Coast Lady Press. ISBN 0-9663072-1-6
  6. ^ The Century Dictionary by The Century Company. Available online at dictionary.com/index.html.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!