Overview

Brief Summary

North American Ecology (US and Canada)

Speyeria cybele is a resident across the central and northern United States and Southern Canada (Scott 1986). Habitats are transition to Canadian zone moist deciduous woods and moist meadows. Host plants are herbaceous and restricted to several species in genus Viola (Violaceae). Eggs are laid haphazardly, near the host plant, and singly. Individuals overwinter as unfed first-instar larvae. There is one flight each year with the approximate flight time June 15-Sept 15, sometimes starting May 1 in the east, and mostly July1-Aug 31 in the west (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

General Description

Our largest fritillary, usually with a wingspan over 65 mm. Unlike some of the other fritillaries, cybele is relatively easy to distinguish by the contrasty, dark basal half of the dorsal hindwing; the basal dark area is smaller and more diffuse in other Speyeria. Cybele also lacks the black, angled spot nearest the anal margin on the dorsal forewing base. Two well-defined subspecies occur in Alberta, pseudocarpenteri inhabiting the parkland and northern prairies, and leto of the southern foothills and prairies. Leto has brighter orange males with smaller upperside dark markings and striking, straw and charcoal females.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southern BC and central Alberta east across southern Canada and the central US to the Atlantic seaboard (Scott 1986). A disjunct population in the Peace River region of AB / BC is the northernmost in North America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Great spangled fritillaries live in the temperate forests of Northern America. Their range includes almost all of Canada and the United States north of Georgia.

Biogeographic Regions: nearctic (Native )

  • Carter, D. 1992. Butterflies and Moths. New York City, New York: Dorling Kindersley, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Great spangled fritillaries live in the temperate forests of Northern America. Their range includes almost all of Canada and the United States north of Georgia.

Biogeographic Regions: nearctic (Native )

  • Carter, D. 1992. Butterflies and Moths. New York City, New York: Dorling Kindersley, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) S. British Columbia south to central California and New Mexico; extends east to the Atlantic from Quebec south to northern Georgia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Great spangled fritillaries are relatively large butterflies with a wingspan of 5.85 to 10.1 cm and a length of 9.1 to 9.9 cm. The sexes are colored differently. The females are paler with a dark blackish color on the rear half of their wings. This pattern is not seen as distincly in males. Both males and females have a pale orange color on the outside of their wings. Both sexes also have a pale orange underside with black spots on the forewings and broad, tan bands on the hindwings.

Great spangled fritillaries' caterpillars have orange spines on a black body.

Range length: 9.1 to 9.9 cm.

Range wingspan: 5.85 to 10.1 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

  • Scott, J. 1986. The Butterflies of North America. Stanford, CA: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Great spangled fritillaries are relatively large butterflies with a wingspan of 5.85 to 10.1 cm and a length of 9.1 to 9.9 cm. Speyeria cybele has scalloped forewings and hindwings. The sexes are colored differently. The females of the species are paler with a dark blackish concentration on the basal half of both their forewings and hindwings. This pattern is not seen as distincly in males. Both males and females have a pale orange color on the outside of their wings. This is where their fritillary spots, black spots near the edges of the wings from whence they get their name, are found. These are black on the forewings and silver on the hindwings. Both sexes also have a pale orange underside with black spots on the forewings and broad, tan bands on the hindwings.

In their larval stage, great spangled fritillaries' caterpillars have orange spines on a black body.

Range length: 9.1 to 9.9 cm.

Range wingspan: 5.85 to 10.1 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

  • Scott, J. 1986. The Butterflies of North America. Stanford, CA: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Aspen parkland, shrubby prairie coulees, open woods of the fotthills and southern boreal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great spangled fritillaries live mostly in temperate climates but can be found in extremes from the arctic to the subtropical. They can be found in both open woodlands and prairies, preferring to be in moist climates.

Habitat Regions: temperate

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great spangled fritillaries live mostly in temperate climates but can be found in extremes from the arctic to the subtropical. They can be found in both open woodlands and prairies, preferring to be in moist climates.

Habitat Regions: temperate

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Occurrences often include a mosaic of open wetlands or meadows and wooded habitats and adults commonly use, and probably breed in, a great variety of habitats with violets. To some extent an edge and open woodland species. Females at least do enter forests in the East, but the signifcance of this is unclear.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Larvae reportedly feed on a number of violet (Viola) species (Scott 1986). It is not known which species are used in western Canada.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

As mature butterflies, great spangled fritillaries, due to their large size, prefer large flowers including violets and thistles.

Similar to many other Lepidoptera, great spangled fritillaries have chemoreceptors on the bottom surfaces of their four walking legs. These allow butterflies to find nectar with their feet. In females, these receptors are adapted to assist in reproduction.

As caterpillars, great spangled fritillaries eat the leaves of violets (Viola rotunidfolia). It does so only at night, spending the day hiding under leaves.

Plant Foods: leaves; nectar

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

As mature butterflies, great spangled fritillaries, due to their large size, prefer large flowers including violets and thistles.

Similar to many other butterflies, great spangled fritillaries have chemoreceptors on the bottom surfaces of their four walking legs. These allow butterflies to find nectar with their feet. In females, these receptors are adapted to assist in reproduction.

As caterpillars, great spangled fritillaries eat the leaves of violets (Viola rotunidfolia). It does so only at night, spending the day hiding under leaves.

Plant Foods: leaves; nectar

Primary Diet: herbivore (Folivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Speyeria cybele in Illinois

Speyeria cybele Fabricius: Nymphalidae, Lepidoptera
(observations are from Robertson, Graenicher, Clinebell, Hapeman, Larson & Barrett, and Broyles & Wyatt; this butterfly is the Great Spangled Fritillary)

Apiaceae: Cicuta maculata sn (Rb); Apocynaceae: Apocynum cannabinum [plab sn] (Rb); Asclepiadaceae: Asclepias exaltata [plup sn] (BW), Asclepias incarnata [plpr sn] (Rb), Asclepias purpurascens [plpr sn fq] (Rb), Asclepias sullivanti [plpr sn] (Rb), Asclepias syriaca [plpr sn] (Rb), Asclepias tuberosa [plpr sn] (Rb), Asclepias verticillata [plab sn] (Rb); Asteraceae: Arctium lappa sn (Gr), Bidens aristosa sn (Rb), Cirsium altissimum sn (Rb, Gr), Cirisum discolor sn (Rb), Cirsium hillii sn fq (Rb), Cirsium vulgare sn (Gr), Coreopsis palmata sn (Rb), Echinacea pallida sn (Cl), Echinacea purpurea sn (Rb, Cl), Echinacea simulata sn (Cl), Eupatoriadelphus purpureus sn (Gr), Eupatorium serotinum sn (Rb), Helianthus annuus sn (Rb), Helianthus grosseserratus sn (Rb), Helianthus strumosus sn (Gr), Heliopsis helianthoides sn (Gr), Liatris pycnostachya sn (Rb, Cl), Liatris spicata sn (Gr), Rudbeckia hirta sn (Rb), Rudbeckia laciniata sn (Gr), Solidago juncea sn (Gr), Vernonia fasciculata sn (Rb); Caprifoliaceae: Symphoricarpos occidentalis sn (Gr); Cornaceae: Cornus obliqua sn (Rb); Fabaceae: Trifolium pratense sn (Rb); Lamiaceae: Blephilia ciliata sn (Rb), Blephilia hirsuta sn (Rb), Monarda bradburiana sn (Rb), Monarda fistulosa sn fq (Rb, Re, Cl), Nepeta cataria sn (Rb), Pycnanthemum tenuifolium sn (Rb); Liliaceae: Lilium canadense sn (Gr), Lilium michiganense sn (Rb), Lilium philadelphicum sn fq (Gr); Melastomataceae: Rhexia virginica exp np (LBt); Orchidaceae: Platanthera peramoena sn (Hpm); Rubiaceae: Cephalanthus occidentalis sn (Rb); Verbenaceae: Verbena stricta sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Speyeria_cybele pollinates different types of plants.

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Speyeria cybele pollinates different types of plants.

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Males use pheromones to attract females. Visual cues are also used in mate recognition. Females use chemical cues to find a suitable host plant on which to lay eggs.

Communication Channels: visual ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults sip flower nectar and occasionally dung. Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Males use pheromones to attract females. Visual cues are also used in mate recognition. Females use chemical cues to find a suitable host plant on which to lay eggs.

Communication Channels: visual ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

One flight per year, most common in early to late July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Unrecorded in Alberta. The pale yellow eggs are laid near or on the host plant. First instar larvae hibernate without feeding. Mature larvae are velvety black with two pale-spotted subdorsal lines and covered with black branched spines, and feed only at night (Scott 1986).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

After hatching from their eggs, Speyeria_cybele caterpillars overwinter and do not become active until the spring. Unlike most butterfly larvae, which molt five times, great spangled fritillary caterpillars molt six times, becoming bigger each time they molt until it they reach the final larval stage.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

After hatching from their eggs, Speyeria cybele caterpillars overwinter and do not become active until the spring. Unlike most butterfly larvae, which molt five times, great spangled fritillary caterpillars molt six times, becoming bigger each time they molt until it they reach the final larval stage.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During mating, males seek out females. A male will perch near a female and open and close his wings. This releases a "strong and spicy" scent from the male's scent scales that can attract females. Males are attracted to females based on their size, color, and how fast they flap their wings. Females have special scent receptors that help them identify the appropriate plants upon which to lay their eggs. The females lay their pale yellow eggs singly near food sources during their migration. These may be laid in late June and July, but the majority are laid in August or September.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

After laying eggs, Lepidoptera exhibit no parental care.

Parental Investment: pre-fertilization (Provisioning)

  • Ahmad, S. 1983. Herbivorous Insects. New York City, New York: Academic Press.
  • Klots, A. 1951. A Field Guide to the Butterflies of North America, East of the Great Plains. Boston, Massachusets: Houghton Mifflin Company.
  • Waldbauer, G. 1996. Insects through the Seasons. London, England: Harvard University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During mating, males seek out females. A male will perch near a female and open and close his wings. This releases a "strong and spicy" scent from the male's scent scales. This aids in courtship due to recognition of and the female's attraction to this scent. Males are attracted to females based on size, color, and the frequency of the flapping of the female's wings. This allows the males to determine the females of their own species as well as the most attractive females of their species. The females have sensilla, chemoreceptors on the ventral surfaces of their forelegs. When looking for a place to lay her eggs, a female will land on a leaf and "drum" the leaf, which involves scraping the surface of the leaf. In doing this the chemoreceptors help the female to identify the plant. The sensilla occur in clusters of 4-12, and each pair of sensilla is located at the same place as a pair of spines. These spines are thought to scratch the leaf surface to allow the oils of the leaf to come into contact with the sensilla. The females lay their pale yellow eggs singly near food sources during their migration. These may be laid in late June and July, but the majority are laid in August or September.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

After laying eggs, butterflies exhibit no parental care.

Parental Investment: pre-fertilization (Provisioning)

  • Ahmad, S. 1983. Herbivorous Insects. New York City, New York: Academic Press.
  • Klots, A. 1951. A Field Guide to the Butterflies of North America, East of the Great Plains. Boston, Massachusets: Houghton Mifflin Company.
  • Waldbauer, G. 1996. Insects through the Seasons. London, England: Harvard University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Speyeria cybele

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 65
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Argynnis cybele

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TGAGCAGGAATAGTAGGAACATCATTAAGTTTATTAATTCGAACTGAATTAGGTAATCCAGGATCACTAATTGGAGAT---GATCAAATTTATAATACCATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAACTGATTAGTCCCCCTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTATAAACAATATAAGATTTTGACTTTTACCCCCATCCTTAATTTTACTTATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCCCCCCTTTCTTCTAATATTGCCCATGGAGGTTCTTCAGTAGATTTAGCAATTTTCTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAACTTTATTACAACAATTATTAATATACGAATTAATAAAATATCTTTTGATCAAATACCATTATTTGTATGAGCAGTAGGAATCACAGCCTTACTTCTTTTACTATCTTTACCAGTTTTAGCAGGAGCTATTACAATACTTTTAACTGATCGTAATTTAAATACTTCTTTTTTTGACCCTGCGGGAGGAGGAGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCTGAANNNNNTATTTTAATTTTACCGGGATTTGGAATAATTTCTCATATTATTTCTCAAGAAAGAGGAAAAAAAGAAACTTTTGGATGTTTAGGAATAATTTATGCTATAATAGCTATTGGCTTATTAGGATTTATTGTATGAGCTCACCATATATTTACAGTTGGAATAGATATTGATACTCGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Argynnis cybele

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great spangled fritillaries have an extremely large range. Some of the temperate forests and rainforests within its range are threatened, but that has not had an effect on their numbers.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great spangled fritillaries have an extremely large range. Some of the temperate forests and rainforests within its range are threatened, but that has not had an effect on their numbers.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and common. No major threats known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Biological Research Needs: Some Pacific NW populations ssps. may require monitoring.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Great spangled fritillaries do not have a negative effect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

As most butterflies do, great spangled fritillaries, while feeding on nectar, pollinate the flowers they visit. This promotes diversity by making self-fertilization less likely. This benefits humans in that it keeps these species of flowers viable and alive.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Great spangled fritillaries do not have a negative effect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

As most butterflies do, great spangled fritillaries, while feeding on nectar, pollinate the flowers they visit. This promotes diversity by making self-fertilization less likely. This benefits humans in that it keeps these species of flowers viable and alive.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great Spangled Fritillary

The Great Spangled Fritillary (Speyeria cybele) is a butterfly of the Nymphalidae family.

Great Spangled Fritillary Speyeria cybele Damaged 2397px.jpg

Description[edit]

Its wingspan ranges from 62 to 88 mm (2.4 to 3.5 in).[1] It is characterized by its orange color above with five black dashes near fore wing base and several iregualer black dashes at the base of the hind wing. In addition, two rows of black crescents run along the edges of the wings. Below, the fore wing is yellowish-orange with black marks similar to the upperside, with a few silver spots on the tip of the wing. The hind wing is reddish-brown with silver spots on the base and middle of the wing. A broad yellow band and silver triangles are the most notable qualities on the wing, next to the brown margin. Females tend to be darker than males and individuals from the western reaches of this species range tend to be brighter orange.Similar species include the Aphrodite Fritillary (Speyeria aphrodite), the Atlantis Fritillary (Speyeria atlantis) and the Northwestern Fritillary (Speyeria hesperis). It is distinguished from the Aphrodite and Atlantis Fritillaries by a wide light submarginal band on the hindwing and instead of black spots, black dashes form on the margins of the fore wing.

Subspecies[edit]

Listed alphabetically.[2]

  • S. c. carpenterii (Edwards, 1876)
  • S. c. charlottii (Barnes, 1897)
  • S. c. krautwurmi (Holland, 1931) – Krautwurm's Fritillary
  • S. c. leto (Behr, 1862)
  • S. c. letona dos Passos & Grey, 1945
  • S. c. novascotiae (McDunnough, 1935)
  • S. c. pseudocarpenteri (F. & R. Chermock, 1940)
  • S. c. pugetensis Chermock & Frechin, 1947

Range[edit]

The Great Spangled Fritillary covers a wide range of North America stretching from southern Canada to northern California on the West to North Carolina on the East. Prime habitat for this species includes moist meadows and woodland edges.

Larval host[edit]

Various species of native violets have reported to serve as a larval host plant for the Great Spangled Fritillary, including the native Round-leaf Violet (Viola rotundifolia), the Arrow-leaf Violet (Viola fimbriatula) and the Common Blue Violet (Viola sororia).[3][4]

Other[edit]

In 1985 Scottish music band Cocteau Twins released a song called "Great Spangled Fritillary"; it was the first of four tracks (each bearing Lepidoptera-influenced names) on their EP Echoes in a Shallow Bay.

References[edit]

  1. ^ Great Spangled Fritillary, Butterflies of Canada
  2. ^ Speyeria, funet.fi
  3. ^ Stichter, Sharon (2011). "Great Spangled Fritillary". The Butterflies of Massachusetts. Retrieved 14 May 2013. 
  4. ^ "Great Spangled Fritillary". Mass Audubon. Retrieved 14 May 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!