Overview

Brief Summary

North American Ecology (US and Canada)

Euptoieta hegesia is a resident in North America only in the very tip of s. Tex., and migratory northward occasionally to s. Calif. It ranges south to Argentina, the Bahamas, and the Greater Antilles (Scott 1986). Habitats are open subtropical areas. Host plants is mostly herbaceous Passiflora foetida in North America, and include species from other families further south including Turneraceae and Convolvulaceae. There are multiple flights year round in Mexico, and July1-Dec. 31 in s. Tex. (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euptoieta hegesia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACATCTTTAAGTCTTATTATTCGAACTGAACTAGGTAATCCTGGATTTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCATTAATACTTGGAGCTCCAGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGATTACTNCCCCCCTCTTTAATTCTTTTAATTTCAAGTAGTATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCTTTATCCTCTAATATTGCTCATGGAGGCTCCTCAGTTGATTTAGCTATTTTTTCCCTACATTTAGCTGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAGTTAATAATATATCTTATGATCAAATACCTTTATTTGTGTGATCTGTAGGAATTACAGCTCTATTATTACTNNNNTCATTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATCNATTTTGATTTTTTGGTCACCCTGAAGTTTATATTCTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTTCTCAAGAAAGAGGTAAAAAGGAAACATTTGGATCTTTAGGTATAATCTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTATGAGCCCATCATATATTTACAGTTGGAATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Euptoieta hegesia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Euptoieta hegesia

The Mexican Fritillary (Euptoieta hegesia) is a North and South American butterfly in the family Nymphalidae.

Contents

Description

The upper side of the wings is bright orange with the basal part of the hind wing unmarked. There is a row of submarginal black spots on both the fore wing and the hind wing. The underside of the wings is yellow-orange with no submarginal black spots.[1] It has a wingspan of 2.5 to 3 inches.[2]

Similar Species

The only similar species in the Mexican Fritillary's range is the Variegated Fritillary (Euptoieta claudia). The Variegated Fritillary has black median lines on the upper side of the hind wing, and on the underside of the hind wing it has a pale postmedian band.[1]

Flight

The Mexican Fritillary may be seen from mid-June to November in Arizona, from July to December in Texas and year-round in Mexico.[2][3]

Habitat

This species may be encountered in a wide range of open habitats and gardens.[2]

Life cycle

The larva is shiny red, with middorsal silver spots edged with black. It has a subdorsal row of white spots ringed with black, a spiracular silver line with black edges, and six rows of black spines. The red head has two long black spines with clubbed ends. The chrysalis is dark brown or rarely tan, with gold eyes and short gold lateral and subdorsal cones. On the wing cases, it has a black marking shaped like a "T". It has 1-3 broods per year.[3]

Host Plants

Here is a list of host plants used by the Mexican Fritillary:

References

  1. ^ a b Jim P. Brock and Kenn Kaufman (2003). Butterflies of North America. Houghton Mifflin, New York, NY. ISBN 0-618-15312-8
  2. ^ a b c d Bob Stewart, Priscilla Brodkin and Hank Brodkin (2001). Butterflies of Arizona. West Coast Lady Press, Arcata, CA. ISBN 0-9663072-1-6
  3. ^ a b c James A. Scott (1986). The Butterflies of North America. Stanford University Press, Stanford, CA. ISBN 0-8047-2013-4


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 1 person

Average rating: 2.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!