Overview

Brief Summary

North American Ecology (US and Canada)

Euptoieta claudia is resident in the Southern United States and migratory northward throughout most of the United States and into Canada (Scott 1986). This species ranges south to Argentina, the Bahamas and the Greater Antilles. Habitats are open areas such as grassland, fields, scrub and open woodland. Host plants are herbaceous and include species from many families including Violaceae, Linaceae, Nyctaginaceae, Turneraceae, Crassulaceae, Menispermaceae, Portulacaceae, Plantaginaceae. Eggs are laid on the host plant singly. Individuals overwinter in the south. There are multiple flights all year in s Tes, and Mar1-Dec 31 in Fla. (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

Unlike the Speyeria fritillaries, the underside lacks all silvery markings. The elongate forewing shape is also unique. There are no described subspecies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The distribution is centered on central America, ranging south to Argentina and occasionally migrating as far north as southern Canada. A single record from Churchill, Manitoba (Scott 1986, Layberry et al. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) S. California east to Florida and the Southern plains. Periodically emigrates as far north as the Northwest Ter- ritories. Also occurs southward to Argentina.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Prairie and alpine meadows, pastures, and roadsides; migratory and ubiquitous.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Virtually any open to sparsely treed habitat. A stray or opportunistic transient breeder in most of US and entire Canadian range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Scott (1986) lists many larval hosts in 10 different families, some of which are strictly tropical. Potential hosts that occur in Alberta include violets (Viola), plantain (Plantago), flax (Linum) and stonecrop (Sedum). Gary Anweiler observed a female ovipositing on a tiny, unfurling violet leaf on a campground gravel pad near Trochu.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Euptoieta claudia in Illinois

Euptoieta claudia Cramer: Nymphalidae, Lepidoptera
(observations are from Robertson, Clinebell, Fothergill & Vaughn; this butterfly is the Variegated Fritillary)

Asteraceae: Aster pilosus sn (Rb), Aster salicifolius sn (Rb), Echinacea pallida sn (Cl), Echinacea purpurea sn (Rb), Helianthus grosseserratus sn (Rb); Fabaceae: Trifolium repens sn (Rb, FV); Lamiaceae: Pycnanthemum tenuifolium sn (Rb); Verbenaceae: Verbena stricta sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Migrants arrive in June, and their offspring emerge mid July to mid August, occasionally into Oct.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The pale green or cream-coloured eggs are laid singly (Scott 1986). Grown larvae are reddish with black and white bands and black spines (Layberry et al. 1998). The strikingly ornate pupa is shiny greenish-cream with small black dots and gold tubercles (Scott 1986).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euptoieta claudia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGCATAGTAGGGACATCTCTTAGTTTATTAATTCGAACTGAATTAGGTAACCCAGGCTCATTAATTGGAGAT---GACCAAATTTATAATACTATTGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATCCCTTTAATACTTGGAGCCCCAGATATAGCTTTCCCCCGTATAAATAATATAAGATTCTGGTTATTACCCCCCTCTTTAATATTACTAATTTCTAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCTCCTTTATCCTCTAATATTGCCCATGGGGGATCTTCAGTAGACTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGTGTTAATAATATGTCATTTGATCAAATACCATTATTTGTTTGAGCAGTTGGAATTACAGCCCTTTTATTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACAGACCGAAATCTTAATACTTCATTTTTTGACCCTGCTGGTGGAGGAGACCCTATCTTATACCAACATTTATTTTGATTTTTTGGTNNNNNNGAAGTTTATATTCTTATTCTTCCAGGATTCGGTATAATTTCTCATATTATTTCTCAAGAAAGAGGGAAAAAAGAAACTTTTGGATCCTTAGGTATAATTTATGCTATAATAGCAATTGGTCTACTAGGATTTATTGTTTGAGCCCATCATATATTTACAGTTGGAATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Euptoieta claudia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and abundant; tolerates disturbance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Euptoieta claudia

The Variegated Fritillary (Euptoieta claudia) is a North and South American butterfly in the family Nymphalidae. Even though the Variegated Fritillary has some very different characteristics from the Speyeria Fritillaries, it is still closely related to them. Some of the differences are: Variegated Fritillaries have 2–3 broods per year vs. one per year in Speyeria; they are nomadic vs. sedentary; and they use a wide range of host plants vs. just violets. And because of their use of passionflowers as a host plant, Variegated Fritillaries also have taxonomic links to the heliconians. Their flight is low and swift, but even when resting or nectaring, this species is extremely difficult to approach, and, because of this, its genus name was taken from the Greek word euptoietos meaning "easily scared".[1]

Contents

Description

Underside of Wings

For a key to the terms used see Lepidopteran glossary.

The upper side of the wings is checkered with orange and black. Both the fore wing and hind wing have a row of submarginal black spots and black median lines running across the wings.[2][3] The underside of the fore wing is orange with a pale orange spot rimmed in black in the fore wing cell. The underside of the hind wing is mottled with browns and grays with a pale postmedian band. There is no silvering.[3] The wingspan measures 1.75–2.25 inches.[4]

Similar species

In the Variegated Fritillary’s range, the only similar species is the Mexican Fritillary (Euptoieta hegesia). The Mexican Fritillary is brighter orange, the upper side of its hind wing basal area is unmarked, and the underside of its wings is plainer, with no submarginal spots or median black lines.[2][3]

Flight period

This species may be seen flying from April–October in the south, while in the north it flies from summer to early fall.[5]

Habitat

This butterfly is often found in open, disturbed habitats such as clover and alfalfa fields, pastures, fields, waste areas, roadsides, and mountain meadows.[1][6]

Nectar plants

Here is a list of some of the flowers that the Variegated Fritillary uses as nectar plants:

Life cycle

Larva
Chrysalis

Males actively patrol for females.[1] Females lay their pale green or cream colored eggs singly on host plant leaves and stems. The larva eats the leaves, flowers, and stems of the food plant.[1][8] The larva is red with black subdorsal and spiracular stripes infused with white spotting. In many individuals, the white is more conspicuous than the black. The red middorsal stripe bears white (sometimes black) oval shaped spots, one per segment.[9] It has six rows of black spines and has a pair of long, clubbed spines on the head.[5][8] The chrysalis is mainly shiny white, with small black spots, a variable amount of brown markings, and orange and gold tubercules. Adults overwinter in the south and fly north each spring and summer.[8] It has 2–3 broods per year.[3]

Host plants

This is a list of host plants used by the Variegated Fritillary:

References

  1. ^ a b c d Rich Cech and Guy Tudor (2005). The Butterflies of the East Coast. Princeton University Press, Princeton, New Jersey. ISBN 0-691-09055-6
  2. ^ a b Bob Stewart, Priscilla Brodkin, and Hank Brodkin (2001). Butterflies of Arizona. West Coast Lady Press.
  3. ^ a b c d Jim P. Brock and Kenn Kaufman (2003). Butterflies of North America. Houghton Mifflin, New York, NY. ISBN 0-618-15312-8
  4. ^ Ernest M. Shull (1987). The Butterflies of Indiana. Indiana Academy of Science. ISBN 0-253-31292-2
  5. ^ a b Thomas J. Allen, Jim P. Brock, and Jeffrey Glassberg (2005). Caterpillars in the Field and Garden. Oxford University Press Inc., New York, NY. ISBN 0-19-514987-4
  6. ^ a b c David C. Iftner, John A. Shuey, and John V. Calhoun (1992). Butterflies and Skippers of Ohio. College of Biological Sciences and The Ohio State University. ISBN 0-86727-107-8
  7. ^ Judy Burris and Wayne Richards (2006). The Life Cycle of Butterflies. Storey Publishing, North Adams, MA. ISBN 1-58017-618-6
  8. ^ a b c d James A. Scott (1986). The Butterflies of North America. Stanford University Press, Stanford, California. ISBN 0-8047-2013-4
  9. ^ David L. Wagner (2005). Caterpillars of Eastern North America. Princeton University Press, Princeton, New Jersey. ISBN 0-691-12143-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!