Overview

Brief Summary

North American Ecology (US and Canada)

Euphydryas phaeton is a resident of the eastern United States and into southern Canada (Scott 1986). Habitats are wet meadows around Chelone for most colonies in the northeast, drier ridges and other sites are chosen by most of the more southwestern colonies. Host plants are herbaceous or shrubs and include species from many families, including Scrophulariaceae, Valerianaceae, Caprifoliaceae, Plantaginaceae, Oleaceae, and rarely Compositae and Rosaceae. Eggs are laid on the host plant in clusters of 100-600 eggs/clutch. Individuals overwinter as third or fourth instar larvae, under ground litter. There is one flight each year with the approximate flight time late June-early Aug. in the northern part of the range and May 15-June 30 in the southern part of their range (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) SE Manitoba to Nova Scotia, and south to Nebraska, Arkansas, and in the mountains to Georgia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: In most cases wetlands or at least moist meadows with a lot of Chelone glabra. However starting by the 1980s there are populations in southern New England using Plantago as the foodplant for all instars and these occur in artificial habitats. Subspecies OZARKAE is usually in dry rocky oak woodlands with larger Aureolaria (formerly Gerardia) as the foodplants. Such habitats and this genus are occasionally used in the Boston area (Schweitzer), in New York (Shapiro, 1974) and Connecticut. The well known Aureolaria feeding occurrence on West Rock near New Haven is ephemeral and absent most years (Schweitzer many observations 1975-1984)-- with several obvious wetland sources of colonists.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Beside the normal foodplants, post hibernation larvae will eat a number of others--mostly genera with iridoid glycosides including several herbs and even small ash trees.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed on flower nectar. Males perch for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Always one brood witn mid instar larvae hibernating.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euphydryas phaeton

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAATAGGAACTTCTTTAAGTCTTTTAATTCGAACAGAATTAGGAAACCCAGGTTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATGAGATTTTGGTTATTACCCCCCTCACTAATATTATTAATTTCTAGCAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCACAGAGGATCTTCTGTTGATTTAGCGATCTTTTCTCTACATTTAGCCGGAATCTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTGTTAATAATATATTTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTCTTCTTTTATTATTATCACTTCCAGTATTAGCTGGAGCTATTACTATACTCCTTACTGATCGAAATATTAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGTATAATTTCACATATTATTTCTCAAGAAAGAGGAAAAAAAGAAACATTTGGATATTTAGGTATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTATTGTTTGAGCTCACCATATATTTACTGTAGGTATAGATATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Euphydryas phaeton

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Declining in many places, imperiled in some southern parts of the range, however, for now no of range-wide concern. Increased use of exotic Plantago lanceolata as a foodplant starting in Connecticut in the 1970s could be an important adaptation. On the other hand threats from deer are probably increasing. Should be monitored.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Moderate. Generalist or community with some key requirements scarce.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Development, e.g. filling marshes, has probably destoyed most habitats. However now deer may be the largest threat. This has been best documented in Maryland, but probably is or will become a threat in most places where Chelone glabra or Aureolaria spp. are the main foodplants.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: This is hard to assess. For example preserve closed to der hunting probably should be regarded as unprotected in much of the range.

Needs: in many parts of the range deer control will be, or already is, essential. In most places metapopulations are probably necessary to perpetuate this species. Even in southern Connecticut in the 1970s and early 1980s when this was basically are fairly common butterfly and deer were not a problem, colonies often died out, but recolonization was also frequent and wandering females could turn up even in cities. D. Schweitzer

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Baltimore Checkerspot

The Baltimore Checkerspot (Euphydryas phaeton) is a North American butterfly of the family, Nymphalidae. It is the official state insect of the U.S. State of Maryland since 1973.[1]

During its period of growth, the Checkerspot Butterfly will search for a host plant for nourishment. Its native larval host is the White Turtle Head (Chelone glabra), but it has also to some extent made use of the introduced lawn weed English Plantain (Plantago lanceolata)[2] and other plants.[3]

Unlike most butterflies and moths, which overwinter as eggs, pupae, or sometimes adults, the Baltimore Checkerspot overwinters as larvae. In late summer (sometime in July through September depending on latitude, weather, and other factors) the larvae spin a pre-hibernation web on a plant, stop feeding, and remain in the web. Several months later they leave this web and enter the litter (dead grass and leaves and so on) on the ground, where they spend the winter.[4]

References

  1. ^ "Maryland State Insect — Baltimore Checkerspot Butterfly". Maryland State Archives. 2004-06-17. http://www.msa.md.gov/msa/mdmanual/01glance/html/symbols/insect.html.
  2. ^ M. Deane Bowers, Nancy E. Stamp and Sharon K. Collinge (Apr 1992), "Early Stage of Host Range Expansion by a Specialist Herbivore, Euphydryas Phaeton (Nymphalidae)", Ecology 73 (2): 526–536, doi:10.2307/1940758
  3. ^ Euphydryas phaeton (Drury, 1773), Butterflies and Moths of North America
  4. ^ M. Deane Bowers (1978), "Over-wintering behavior in Euphydryas phaeton (Nymphalidae)", Journal of the Lepidopterists' Society 32 (4): 282–288, http://research.yale.edu/peabody/jls/pdfs/1970s/1978/1978-32(4)282-Bowers.pdf


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!