Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:300
Specimens with Sequences:453
Specimens with Barcodes:229
Species:28
Species With Barcodes:28
Public Records:99
Public Species:17
Public BINs:25
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Colostethus cf. pratti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCGTCTTTGGTGCCTGGGCAGGAATAGTTGGAACTGCCCTAAGTCTTTTAATCCGAGCAGAATTAAGCCAGCCTGGCTCACTTTTAGGCGACGATCAAATTTACAATGTGATCGTTACAGCCCACGCTTTTGTAATAATTTTTTTTATAGTTATACCCATTCTTATTGGAGGCTTTGGTAATTGATTAGTTCCCCTGATAATTGGCGCCCCTGACATGGCCTTCCCCCGCATAAATAATATAAGCTTCTGGCTACTGCCCCCCTCATTCCTGTTACTCTTAGCTTCTGCCGGCCTTGAAGCAGGAGCAGGAACTGGATGAACAGTTTATCCCCCTCTAGCCAGCAATCTCGCTCATGCCGGCCCATCAGTTGACCTAACAATTTTTTCCCTTCACCTGGCTGGAGTCTCCTCAATTCTTGGCGCAATTAATTTTATTACCACCACCCTAAATATAAAACCCCCATCACTTACACAGTACCAAACACCTTTGTTTGTATGATCCGTTTTAATCACTGCTATTCTTCTTTTATTATCTCTCCCAGTGCTAGCCGCCGGAATTACAATACTCTTAACTGACCGTAACCTAAACACTACTTTTTTTGACCCTGCTGGAGGCGGAGACCCAATTCTCTACCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colostethus cf. pratti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colostethus

Colostethus is a large genus of poison dart frogs native to Central and South America. There are currently over eighty species in this genus. Unlike most members of the family Dendrobatidae, members of the genus Colostethus are not usually brightly colored or poisonous. Colostethus is paraphyletic as presently delimited, because although all species have a common ancestor, not all species descended from that ancestor are included in Colostethus. Current evolutionary studies will likely result in splitting of Colostethus into segregate genera in the near future.

Since a 2006 review, Hyloxalus has absorbed many of the species, while Silverstoneia aggregated three.[1]

Species[edit]

Silverstoneia[edit]

Moved to Silverstoneia genus by Grant et al., 2006[2]

Notes[edit]

  1. ^ Grant, T., Frost, D. R., Caldwell, J. P., Gagliardo, R., Haddad, C. F. B., Kok, P. J. R., Means, D. B., Noonan, B. P., Schargel, W. E., and Wheeler, W. C. (2006). Phylogenetic systematics of dart-poison frogs and their relatives (Amphibia: Athesphatanura: Dendrobatidae). Bulletin of the American Museum of Natural History, 299, 1-262 (http://digitallibrary.amnh.org/dspace/bitstream/2246/5803/1/B299.pdf)
  2. ^ Grant, T., Frost, D. R., Caldwell, J. P., Gagliardo, R., Haddad, C. F. B., Kok, P. J. R., Means, D. B., Noonan, B. P., Schargel, W. E., and Wheeler, W. C. (2006). Phylogenetic systematics of dart-poison frogs and their relatives (Amphibia: Athesphatanura: Dendrobatidae). Bulletin of the American Museum of Natural History, 299, 1-262 (http://digitallibrary.amnh.org/dspace/bitstream/2246/5803/1/B299.pdf)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!