Overview

Brief Summary

The Scarce Fritillary occurs in clearings or forest fringes, where young ash trees are growing in open, mixed woodland or where nature-like fringe structures with abundant Ligustrum are present. The eggs are laid in one batch on a leaf of Ash (Fraxinus excelsior) or Aspen (Populus tremula), preferably at a height of 4 to 10 m. In continental mixed oak forests, Ligustrum vulgare is the most important initial food plant (eggs on 0, 5–1 m). The populations of the Carpathian basin and southeast Europe can use several Fraxinus species as larval foodplant. In lowland riverine gallery forests Fraxinus angustifolia is the most important one, while in white oak forests Fraxinus ornus is used for oviposition. The butterfly generally has a slow, gliding flight but can speed up when necessary. The caterpillars build a nest of silk and leaves and feed together at first, while still quite small. They go into hibernation, remaining in the nest, which usually falls to the ground onto the woodland floor. In spring, they leave the nest and separate, spreading out in search of food. They use a variety of larval foodplants at this stage, including honeysuckle (Lonicera spp.), plantains (Plantago spp.), privets (Ligustrum spp.), Cow-wheat (Melampyrum spp.) or Speedwell (Veronica spp.). They pupate in the litter layer and on tree-trunks. The species has one generation a year, although in Northern Europe some of the caterpillars hibernate a second time before pupating. Habitats: broad-leaved deciduous forests (42%), mixed woodland (18%), alluvial and very wet forests and brush (7%), mesophile grasslands (7%), humid grasslands and tall herb communities (5%), tree lines, hedges, small woods, bocage, parkland dehesa (5%).

  • Cizek O, Konvička M (2005) What is a patch in a dynamic metapopulation? Mobility of an endangered woodland butterfly, Euphydryas maturna. Ecography 28: 791-800.
  • Eliasson C (1991) Studier av boknatfjarilens, Euphydryas maturna (Lepidoptera, Nymphalidae), forekomst och biologi i Vastmanland = Studies on the beech web butterfly, Euphydryas maturna (Lepidoptera, Nymphalidae), occurrence and biology in Vastmanland. Entomologisk Tidskrift 112: 113-124.
  • Freese A, Beneš J, Bolz R, Cizek O, Dolek M, Geyer A, Gros P, Konvička M, Liegl A, Stettmer C (2006) Habitat use of the endangered butterfly Euphydryas maturna and forestry in Central Europe. Animal Conservation 9: 388-397. doi: 10.1111/j.1469-1795.2006.00045.x
  • Gros P (2002) Habitatmanagement FFH-relevanter Tagfalterarten: Grundlagenstudie für die Entwicklung eines Artenschutzprogrammes zur Förderung von Metapopulationssystemen des Eschen-Scheckenfalters (Euphydryas maturna Linnaeus, 1758). Salzburg: Universität Salzburg.
  • Konvička M, Cizek O, Filipova L, Fric Z, Beneš J, Krupka M, Zamecnik J, Dockalova Z (2005) For whom the bells toll: Demography of the last population of the butterfly Euphydryas maturna in the Czech Republic. Biologia 60: 551-557.
  • Rakosy L, Pecsenye K, Mihali C, Tóth A, Varga Z (in press) Taxonomic review of Euphydryas (Hypodryas) maturna (Linnaeus, 1758) (Lepidoptera, Nymphalidae) with description of a new subspecies from Dobrogea (Romania) and notes on conservation biology. Acta Zoologica Academiae Scientiarum Hungaricae 57.
  • Wahlberg N (1998) The life history and ecology of Euphydryas maturna (Nymphalidae: Melitaeini) in Finland. Nota lepidopterologica 21: 154-169.
  • Wahlberg N (2001) On the status of the scarce fritillary Euphydryas maturna (Lepidoptera : Nymphalidae) in Finland. Entomologica Fennica 12: 244-250.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Chris van Swaay

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euphydryas maturna

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTTTATATTTTATTTTTTGAATTTGAGCAGGAATAGTAGGAACTTCACTAAGTCTTTTAATTCGAACTGAATTAGGAAATCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCACATGCTTTTATTATAATCTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATACTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTATTACCCCCCTCATTAATATTATTAATTTCTAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGCTCATAGTGGATCTTCTGTTGACTTAGCAATTTTTTCCTTGCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGTGTTAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCACTTCTTTTATTACTATCACTACCAGTATTAGCAGGAGCTATTACCATACTTCTCACCGATCGAAATATTAACACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Euphydryas maturna

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
World Conservation Monitoring Centre

Reviewer/s

Contributor/s

History
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Scarce Fritillary

The Scarce Fritillary, Euphydryas maturna, is a species of butterfly in the family Nymphalidae. It is found in Austria, Belgium, Czech Republic, Finland, France, Germany, Greece, Hungary, Kazakhstan, Lithuania, Luxembourg, Poland, Romania, Russia, Serbia and Montenegro, and Sweden.[1]

Underside

References

  1. ^ World Conservation Monitoring Centre (1996). "Hypodryas maturna". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved September 27, 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!