Ecology

Habitat

Depth range based on 171 specimens in 37 taxa.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0 - 111.3
  Temperature range (°C): 5.286 - 9.686
  Nitrate (umol/L): 1.687 - 23.221
  Salinity (PPS): 5.722 - 34.708
  Oxygen (ml/l): 3.625 - 8.684
  Phosphate (umol/l): 0.114 - 1.970
  Silicate (umol/l): 3.113 - 34.412

Graphical representation

Depth range (m): 0 - 111.3

Temperature range (°C): 5.286 - 9.686

Nitrate (umol/L): 1.687 - 23.221

Salinity (PPS): 5.722 - 34.708

Oxygen (ml/l): 3.625 - 8.684

Phosphate (umol/l): 0.114 - 1.970

Silicate (umol/l): 3.113 - 34.412
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Cottus preys on:
Chironomidae
Squamata
Stenonema
Centroptilum
Chimarra
Habrophleboides
Prosimulium
Polypedilum
Eukiefferiella

Based on studies in:
USA: Maine (Lake or pond)
USA: Pennsylvania (River)

This list may not be complete but is based on published studies.
  • J. L. Brooks and E. S. Deevey, New England. In: Limnology in North America, D. G. Frey, Ed. (Univ. of Wisconsin Press, Madison, 1963), pp. 117-162, from p. 143.
  • K. W. Cummins, W. P. Coffman, P. A. Roff, Trophic relationships in a small woodland stream, Verh. Int. Ver. Theor. Angew. Limnol. 16:627-638, from p. 630 (1966).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Cottus is prey of:
Lota
Cristivomer

Based on studies in:
USA: Maine (Lake or pond)

This list may not be complete but is based on published studies.
  • J. L. Brooks and E. S. Deevey, New England. In: Limnology in North America, D. G. Frey, Ed. (Univ. of Wisconsin Press, Madison, 1963), pp. 117-162, from p. 143.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:709
Specimens with Sequences:707
Specimens with Barcodes:616
Species:43
Species With Barcodes:43
Public Records:386
Public Species:36
Public BINs:31
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cottus cf. rhenanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cottus cf. bairdii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCTTTAAGCCTCCTAATTCGAGCAGAATTAAGTCAACCCGGCGCCCTTTTGGGGGACGACCAGATTTATAATGTAATTGTTACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATACCGATTATAATCGGGGGTTTCGGGAACTGGCTCGTTCCCCTAATGATTGGCGCTCCTGATATGGCCTTTCCTCGAATGAATAATATGAGCTTTTGACTTCTTCCCCCATCTTTTTTACTCCTCCTTGCCTCCTCGGGGGTCGAAGCAGGGGCCGGAACCGGATGAACAGTTTACCCACCCCTCGCCGGAAACCTCGCCCACGCAGGAGCCTCTGTTGACCTAACAATCTTCTCCCTTCACCTAGCAGGTATCTCCTCTATTCTTGGAGCAATTAACTTTATCACAACCATCATTAATATAAAACCCCCAGCTATCTCACAATACCAGACCCCGCTCTTTGTATGGTCTGTTCTTATTACTGCTGTCCTACTGCTTCTTTCCCTCCCCGTTCTTGCCGCCGGCATCACAATACTCCTGACAGACCGAAATCTTAACACCACCTTCTTTGACCCCGCCGGAGGAGGGGACCCAATCCTNNNNNNNNNNNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cottus cf. bairdii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cottus cf. carolinae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCTTTAAGCCTCCTAATTCGAGCAGAATTAAGTCAACCCGGCGCCCTTTTGGGGGACGATCAGATTTATAATGTAATTGTTACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATACCGATTATAATCGGAGGCTTCGGGAACTGGCTCGTTCCCCTAATGATTGGCGCTCCTGACATAGCCTTTCCTCGAATGAATAATATGAGCTTTTGACTTCTTCCCCCATCTTTTTTACTCCTCCTTGCCTCTTCGGGAGTCGAAGCAGGGGCCGGAACCGGATGAACAGTTTATCCACCCCTCGCCGGAAATCTCGCCCACGCAGGAGCTTCTGTTGACCTAACAATCTTCTCCCTTCACCTAGCAGGTATCTCCTCTATTCTTGGGGCAATCAACTTTATCACAACTATCATTAATATAAAACCCCCTGCTATTTCACAATACCAGACCCCGCTATTTGTGTGGTCTGTTCTTATCACCGCTGTGCTGCTGCTTCTCTCCCTCCCCGTTCTTGCCGCCGGCATCACAATACTCCTGACAGACCGAAATCTTAACACCACCTTCTTTGACCCTGCCGGAGGAGGGGACCCAATCCTTTACCAACATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cottus cf. carolinae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Current Listing Status Summary

Status: Proposed Endangered
Date Listed:
Lead Region:   Great Lakes-Big Rivers Region (Region 3) 
Where Listed:


For most current information and documents related to the conservation status and management of Cottus, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cottus (genus)

Cottus is a genus of the sculpin family Cottidae. They are often referred to as the "freshwater sculpins", as they are the principal genus of sculpins to be found in fresh water. They are native to the Palearctic and Nearctic.

They are mostly small fish, rarely reaching more than 15 cm in length.

Species[edit]

There are currently 67 recognized species in this genus:

References[edit]

  1. ^ Kinziger, A.P. & Wood, R.M. (2010): Cottus immaculatus, a new species of sculpin (Cottidae) from the Ozark Highlands of Arkansas and Missouri, USA. Zootaxa, 2340: 50–64.
  2. ^ Sideleva, V.G. & Goto, A. (2012): A New Species of Sculpin Cottus kolymensis sp. nova (Scorpaeniformes, Cottidae) from Rivers of Kolyma. Voprosy Ikhtiologii, 52 (3): 288-294.
  3. ^ Lemoine, M., Young, M.K., McKelvey, K.S., Eby, L., Pilgrim, K.L. & Schwartz, M.K. (2014): Cottus schitsuumsh, a new species of sculpin (Scorpaeniformes: Cottidae) in the Columbia River basin, Idaho-Montana, USA. Zootaxa, 3755 (3): 241–258.
  4. ^ Adams, G.L., Burr, B.M., Day, J.L. & Starkey, D.E. (2013): Cottus specus, a new troglomorphic species of sculpin (Cottidae) from southeastern Missouri. Zootaxa, 3609 (5): 484–494.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!