Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Vanessa braziliensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Vanessa braziliensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCACTTAGTTTATTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACAATTGTCACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCCCTAATATTAGGAGCTCCTGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGACTTTTACCCCCATCATTAATATTATTAATTTCTAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATAGAGGATCATCTGTAGATTTAGCAATTTTTTCCCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAGTTAACAGTATATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCTTTACTTTTATTACTTTCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATATTAATACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTCTTTACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCAGGTTTCGGAATAATTTCACATATTATTTCTCAAGAAAGAGGAAAAAAGGAAACTTTTGGATGCTTAGGAATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTATTGTTTGAGCACATCATATGTTTACAGTAGGTATAGATATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Vanessa braziliensis

The Brazilian Painted Lady (Vanessa braziliensis) is a butterfly of the Nymphalidae family found in Brazil, Bolivia and Argentina.[1]

References[edit]

  1. ^ Vanessa, funet.fi
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!