Overview

Brief Summary

North American Ecology (US and Canada)

Boloria bellona is a year round resident across the northern United States and southern Canada, from Labrador south to the mid-Atlantic, west to central British Columbia, with several smaller separate populations in central US states (Scott 1986). Habitats are moist meadows in upper transition to Hudsonian zones. Host plants are restricted to one herbaceous genus, Viola (Violaceae). Eggs are laid haphazardly around the host plant. Individuals overwinter as third- or fourth-instar larvae. There are variable numbers of flights (up to three) each year depending on latitude between May15- early Sep. (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

General Description

The upperside is bright orange with multiple rows of black spots, and the hindwing underside is purple-brown, lacking prominent pale markings. The spring brood has a slightly darker upperside. Most similar to B. epithore and B. frigga, it can be separated by the shape of the forewing outer margin: it is slighlty angled out, giving a squared-off look. The forewing is evenly rouned in epithore and frigga.  Subspecies jenistorum (=jenistae), described from Rivercourse, Alberta (Kondla 1996), occurs throughout the province. 
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southern Yukon to southerm Montana and northen Washington, east tot the Atlantic coast. Isolated populations occur in the southern Rocky Mountain states (Scott 1986).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Northwest Territories and British Columbia east to Quebec, and south to Washington, Colorado, Missouri, North Carolina. Range of this species is expanding to the south and east.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Open woodlands and meadows, particularly in the parkland and foothills region.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eastward mostly in moist, but not really wet, artificial grasslands such as hay meadows, pastures, roadsides usually on rich soils but also in some natural wetlands such as sedge meadows (e.g Layberry et al., 1998; Iftner et al., 1992). Westward in more natural habitats such as moist meadows, aspen parklands and prairies (Opler, 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

The larvae are variously reported to feed on violets (Viola spp.), but there are no confirmed records for Alberta. In BC it is asociated with Viola canadensis (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Boloria bellona in Illinois

Boloria bellona Fabricius: Nymphalidae, Lepidoptera
(observations are from Graenicher; this butterfly is the Meadow Fritillary)

Asteraceae: Eupatoriadelphus purpureus sn (Gr), Eupatorium perfoliatum sn (Gr), Rudbeckia hirta sn (Gr)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Appears to be secure across most of its range except for IA, NE, and WA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Two flights each season, peaking mid May to mid June and late July to early August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The white eggs are laid near, but not often on, the larval hostplants (Scott 1986), and hatch in about 11 days (Bird et al. 1995). Mature larvae look much like those of B. selene, but have a purplish cast to them (Scott 1986, Guppy & Shepard 2001). The third or fourth instar larvae (of the second brood) overwinter (Scott 1986). This is our most common and widespread Boloria, and can be found in mesic habitats as well as dry prairie and pastures.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Boloria bellona

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Boloria bellona

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTCTTAGCCTATTAATTCGAACTGAATTAGGTAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCGTCTTTAATTTTACTTATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATAGAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGTATTTCTTCTATTCTAGGAGCTATTAATTTTATCACTACAATTATTAATATACGAATTAATAATATATCATTCGACCAAATACCATTATTCGTTTGAGCTGTAGGTATTACAGCACTATTACTTTTATTATCTTTACCAGTTTTAGCCGGAGCTATTACAATACTTTTAACCGATCGTAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGTGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and abundant; range expanding in midwest and mid-Alantic.

Other Considerations: Adapted to hayfields.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Boloria bellona

The Meadow Fritillary (Boloria bellona) is a North American butterfly in the brushfoot family, Nymphalidae. The common name, Meadow Fritillary, is also used for a European butterfly species, Melitaea parthenoides.

Description[edit]

Underside of the wings

For a key to the terms used see Lepidopteran glossary

The upper side of the wings is yellow-orange with dark spots, lines, and zigzagged bands. The fore wing is squared off just below the apex. A dark border on the hind wing margin is lacking on most individuals. It has long palps. The underside of the wings are mottled with orange and purplish-brown. There is a yellowish band that runs across the center of the hind wing. It lacks the silver spots most lesser fritillaries have. The fore wing is smudged with orange and brown near the apex. The wingspan of the Meadow Fritillary is 3.5 - 5.1 cm (1 3/8 - 2 inches).

Similar Species[edit]

Similar species in the Meadow Fritillary's range include the Silver-bordered Fritillary, (Boloria selene), the Bog Fritillary, (Boloria eunomia), and the Purplish Fritillary, (Boloria chariclea).

The Silver-bordered Fritillary has rounder wings than the Meadow Fritillary, has a dark hind wing margin border, and has silver spots on the underside of the hind wing.

The Bog Fritillary is a bit smaller than the Meadow Fritillary, its wing bases are hairy, and on the underside of the hind wing are a series of bands and patches which are rust-red, yellow, and white.

The Purplish Fritillary is also a bit smaller than the Meadow Fritillary, and the underside of the hind wings are a deep, rusty red.

Habitat[edit]

The Meadow Fritillary is frequently encountered in wet, open places, including pastures, fields, and streamsides.

Life cycle[edit]

The female is the active flight partner. Females deposit greenish-yellow eggs near the host plant on twigs or leaves. Mature larvae are gray and black with small, light colored spines. The chrysalis is yellow-brown. The Meadow Fritillary overwinters as a larva. It has 1–2 broods per year.

Host Plants[edit]

Here are a list of host plants used by the Meadow Fritillary:

Image gallery[edit]

References[edit]

  • Jim P. Brock and Kenn Kaufman. 2003. Butterflies of North America. Houghton Mifflin, New York. ISBN 0-618-15312-8
  • Ernest M. Shull. 1987. The Butterflies of Indiana. by Indiana Academy of Science. ISBN 0-253-31292-2
  • Rick Cech and Guy Tudor. 2005. Butterflies of the East Coast. Princeton University Press, Princeton, New Jersey. ISBN 0-691-09055-6
  • David L. Wagner. 2005. Caterpillars of Eastern North America. Princeton University Press, Princeton, New Jersey. ISBN 0-691-12143-5

Further reading[edit]

  • Glassberg, Jeffrey Butterflies through Binoculars, The West (2001)
  • Guppy, Crispin S. and Shepard, Jon H. Butterflies of British Columbia (2001)
  • James, David G. and Nunnallee, David Life Histories of Cascadia Butterflies (2011)
  • Pelham, Jonathan Catalogue of the Butterflies of the United States and Canada (2008)
  • Pyle, Robert Michael The Butterflies of Cascadia (2002)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Two additional subspecies are usually recognized although Scott combine JENISTAI under TODDI. Various authors have interpreted the ranges of the subspecies quite differently. There appears to be no compelling reason to recognize them.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!