Overview

Brief Summary

North American Ecology (US and Canada)

Chlosyne nycteis is resident to the eastern United States and southeastern Canada, as well as a few isolated populations further west (Scott 1986). Habitats are streamsides, moist meadows, open moist deciduous woods. Host plants are herbaceous species restricted to family Compositae. Eggs are laid on the host plant in clusters averaging 121 eggs per clutch. Individuals overwinter as third instar larvae, in a special skin. There is a variable number of flights each year depending on latitude with one flight in the north and high altitude between June 1-July15, and multiple flights in the southern part of the range from Mar.1-Sept30. (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Habitats vary greatly in large part with foodplant in different parts of range, for example near a stream and in adjacent pitch pine barren in southern Maine, trap rock glades in ridgetop oak woodland in Connecticut but usually along streams in Canada. Mostly dry rocky ridgetop woodland or riparian areas through forests eastward. Can occur especially along paths or small streams in rather heavily shaded areas so forest checkoffs seem appropriate, but typically a woodland species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Chlosyne nycteis in Illinois

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed on flower nectar and mud in the east. Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chlosyne nycteis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGTATAGTTGGAACATCTTTAAGACTTCTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCCTTAATATTAGGAGCCCCAGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACTATTACCCCCATCACTAATTCTCTTAATTTCTAGAAGAATTGTAGAAAATGGTGCAGGTACGGGATGAACAGTGTACCCCCCACTTTCTTCTAATATCGCCCATAGAGGATCATCCGTTGATTTAGCAATCTTCTCACTACATTTAGCGGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAGTTAATAATATATCCTTTGATCAGATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTCTTTTATTATTATTATCATTACCTGTATTAGCTGGAGCTATTACCATACTTCTAACAGATCGAAATATTAATACATCATTTTTTGACCCTGCTGGTGGAGGTGACCCAATTTTATACCAACATTTATTTTGATTTTTTGGNNNNNNTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATTATCTCCCAAGAAAGAGGAAAAAAGGAAACTTTTGGTTGTTTAGGTATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTATGAGCTCACCACATATTTACTGTAGGAATAGACATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chlosyne nycteis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The name ismeria was suppressed by ICZN in 2006. Therefore it is a moot point whether it originally applied to this species as Gatrelle (2003) concluded or to C. gorgone as nearly every one else concluded. C. nycteis seems to form foodplant races in the east, e.g. a univoltine woodland Helianthus-feeding biotype is possibly a recently extinct (due to deer?) from Connecticut to northern New Jersey, wingstem-ffeding version in lowlands from southeast Pennsylvania to Georgia, unknown, but neither of these, in Maine. No such host races have been given taxonomic status and Gatrelle (2003) makes no attempt to evaluate foodplants of the various subspecies he recognizes based on wing maculation. While Gatrelle recognizes three subspecies in the east, one of which he names as new, without a more thorough review of overall variation south of about the Mason-Dixon line and Ohio River there seems no compelling reason to recognize eastern subspecies. If it holds up as a valid taxon, the southern lowland one that Gatrelle considers to be ismeria might possibly be of conservation concern.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!