Overview

Brief Summary

Introduction

Etymology: Hecale was a priestess of Zeus in Athens. She had offered to sacrifice to Zeus if Theseus would come back safe after meeting the Marathonian Bull, but she died before Theseus' return (Hecale).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Habits

H. hecale occurs from sea level to 1,400 m in tall forests. Usually individuals fly rapidly in the canopy and erratically in the lowerstory. Females mate multiply and adults roost solitarily or in loose groups at night at 2-10 m above ground on twigs or tendrils.

Hostplant: H. hecale larvae feed primarily on plants from the subgenera Granadilla and Distephana (Passifloraceae), as a secondary source H. hecale use Astrophea and in laboratory conditions they accept Dysosmia (Passifloraceae) (Brown, 1981). In Panama H. hecale most commonly feeds on Passiflora vitifolia (C. Jiggins, pers obs.)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Characteristics

Early stages: Eggs are yellow and approximately 1.9 x 0.9 mm (h x w). Females usually place eggs singly on growing shoots and tendrils of the host plant. Mature larvae have a white body with black scoli, orange head, and all spines, spiracles and dots in the dorsum are black; length is around 1.8 cm. Caterpillars are gregarious in small numbers (Brown, 1981). Pupae are brown with three gold spots on the dorsum, the thorax is strongly bowed and have five pairs of black spines in the abdomen. The head has short head horns and the antennae have many short black spines (DeVries, 1997).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Distribution

Heliconius hecale is distributed from Central America to the Amazon. The map below shows an approximate representation of the geographic distribution of this species. The original data used to draw these maps are derived from Brown (1979) which is available at Keith S. Brown Jr. (1979). Ecological Geography and Evolution in Neotropical Forests.

Distribution of Heliconius hecale. © 2002 Margarita Beltran.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heliconius hecale

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAACATAAGATTTTGACTTTTACCCCCGTCATTAATTTTACTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATGGAGGATCATCTGTTGATTTAGCCATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACCACTATTATTAATATACGAATTAATAATATATCTTTTGATCAATTACCATTATTTGTTTGAGCTGTTGGTATTACAGCATTATTATTACTCTTATCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCTTTTTTTGACCCCGCAGGAGGAGGCGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGGCATCCTGAAGTATATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATTATTTCTCAAGAAAGTGGCAAAAAGGAAACTTTTGGTTGCTTAGGAATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTAGGAATAGATATTGATACACGAGCTTATTTTACTTCAGCAACTATAATTATTGCAGTTCCTACAGGAATTAAAATTTTTAGTTGATTAGCAACTTTACATGGAACA---CAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Heliconius hecale

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Heliconius hecale

The Tiger Longwing, Hecale Longwing, Golden Longwing, or Golden Heliconian (Heliconius hecale) is a Heliconiid butterfly that occurs from Mexico to the Peruvian Amazon.[1]

Subspecies[edit]

Listed alphabetically.[2]

  • H. h. anderida Hewitson, [1853]
  • H. h. annetta Riffarth, 1900
  • H. h. australis Brown, 1976
  • H. h. barcanti Brown, 1976
  • H. h. clearei Hall, 1930
  • H. h. discomaculatus Weymer, 1891
  • H. h. ennius Weymer, 1891
  • H. h. felix Weymer, 1894
  • H. h. fornarina Hewitson, [1854]
  • H. h. hecale (Fabricius, 1775)
  • H. h. holcophorus Staudinger, [1897]
  • H. h. humboldti Neustetter, 1928
  • H. h. ithaca C. & R. Felder, 1862
  • H. h. latus Riffarth, 1900
  • H. h. melicerta Bates, 1866
  • H. h. metellus Weymer, 1894
  • H. h. naxos Neukirchen, 1998
  • H. h. nigrofasciatus Weymer, 1894
  • H. h. novatus Bates, 1867
  • H. h. paraensis Riffarth, 1900
  • H. h. paulus Neukirchen, 1998
  • H. h. quitalena Hewitson, [1853]
  • H. h. rosalesi Brown & Fernández, 1976
  • H. h. sisyphus Salvin, 1871
  • H. h. shanki Lamas & Brown, 1976
  • H. h. sulphureus Weymer, 1894
  • H. h. vetustus Butler, 1873
  • H. h. zeus Neukirchen, 1995
  • H. h. zuleika Hewitson, 1854

Gallery[edit]

References[edit]

  1. ^ Hecale Longwing, Neotropical Butterflies
  2. ^ Heliconius hecale, funet.fi


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!