Overview

Brief Summary

Biology

One of the first fritillaries to emerge, the flight period lasts for about six weeks and occurs between the end of April and late July. A single brood is usually produced; eggs are laid singly on dead bracken or leaf litter near the foodplant (3). The caterpillars emerge after about two weeks (2) and when they are still small (5) they hibernate amongst leaf litter and emerge the following spring to complete their development. They pupate in the leaf litter and adults emerge after a few weeks (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The pearl-bordered fritillary is pale orange brown in colour with black spots. The underside is paler with reddish brown hindwings featuring pearly silver spots. Both sexes are similar in appearance. The caterpillar is about 2.5 centimetres in length, and has a black body with black, yellow or white spines along the back (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Widespread throughout Europe from northern Spain to Scandinavia, reaching as far east as Russia. Once widespread throughout much of Britain, the pearl-bordered fritillary has suffered a severe and rapid decline in England and Wales over last 50 years (4). It has become locally extinct in most of Wales, and central and eastern England (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Found in woodland clearings, open deciduous wood pasture in Scotland, and in free-draining areas with a patchwork of grass, bracken and some scrub. The pearl-bordered fritillary requires abundant supplies of the main foodplants, common dog-violet (Viola riviniana) (3) and other Viola species (2) for the caterpillars, and plenty of nectar-rich spring flowers for the adults to feed on (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Boloria euphrosyne

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACATCTCTTAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACTATCGTAACAGCTCATGCCTTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATAGCATTCCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAATTTTACTTATTTCAAGTAGAATTGTCGAAAATGGAGCAGGAACAGGATGAACAGTCTACCCACCCCTTTCATCTAATCTTGCCCATAGAGGAACTTCAGTAGATCTAGCAATTTTTTCCTTACATTTAGCAGGTATTTCCTCCATTTTAGGAGCTATTAACTTTATTACTACAATTATTAATATACGAATTAATAATATATCTTTTGACCAAATACCACTATTTGTATGAGCTGTAGGAATTACAGCTTTATTACTTTTACTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGACCCCGCAGGAGGTGGAGATCCCATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTNNNTATTTTAATTCTTCCAGGATTTGGTATAATTTCACATATTATTTCTCAAGAAAGAGGAAAAAAAGAAACTTTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTTGGAATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Boloria euphrosyne

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 58
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Clossiana euphrosyne

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTCTTAGTTTATTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCATTAATATTAGGAGCCCCAGACATAGCATTTCCACGTATAAATAATATAAGATTTTGACTTCTACCCCCCTCCCTTATTTTACTTATTTCGAGAAGAATCGTCGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCTCCCCTCTCATCTAATATTGCTCATAGAGGTGCCTCAGTAGACTTAGCAATCTTTTCCTTACATTTAGCAGGTATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCATTATTTGTATGAGCAGTAGGTATTACTGCATTATTACTTTTACTATCTTTACCTGTTTTAGCAGGAGCTATTACAATACTTTTAACTGACCGTAATTTAAATACTTCATTTTTTGACCCCGCTGGAGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Clossiana euphrosyne

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Status

Listed on Schedule 5 of the Wildlife and Countryside Act, 1981 with respect to sale (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

In Britain, The pearl-bordered fritillary is currently one of the most rapidly declining butterflies. The main reason for the decline seems to be inappropriate habitat management, particularly the decline in woodland coppicing and loss of open areas and broad rides. In the last 20 years there has been a high level of local extinctions, this is thought to be due to the maturation of forestry plantations created in the 1950s and 60s, which have now become too dense for this species (3). Loss of suitable bracken habitat has also occurred, either because of bracken removal or overgrowth and scrub invasion (3). Grazing by livestock and the trampling that accompanies it, can help to maintain suitable habitat (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

In key areas, appropriate grazing should be maintained and encouraged through agri-environment schemes. In a number of nature reserves supporting the pearl-bordered fritillary, traditional coppice management has been reinstated with promising results. However many large populations are at risk in Scotland due to the practice of fencing off woodland and promoting natural regeneration, which although beneficial for some species, will result in a loss of edge habitat and clearings needed by this and other species of butterfly (3). The pearl-bordered fritillary is a priority species under the UK Biodiversity Action Plan (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pearl-bordered Fritillary

The Pearl-bordered Fritillary (Boloria euphrosyne) is a butterfly of the Nymphalidae family.

It is orange with black spots on the upperside of its wing and has a wingspan of 38–46 mm. On the underside of the wings there is a row of silver pearly markings along the edge, which give the species its name. It is often confused with the Small Pearl-bordered Fritillary, but can be distinguished from it by the triangle along its pearl-border (the Small Pearl-bordered has black chevrons) as well as the presence of a single silver spot in the middle of a row of yellow spots. The female has both darker markings and rounder wings than the male. The caterpillars are black with white or yellow spines along their backs.

Like other species of fritillary, the males have special scent glands on their wings so that they can be recognised by females of their own species and therefore find a suitable partner.

Distribution[edit]

It is widespread throughout Europe, ranging from Scandinavia to northern Spain and from Ireland eastwards towards Russia and Asia. In England and Wales (plus another 10 countries) it has declined rapidly in number and is a highly threatened species - nbn gateway distribution map.

Subspecies[edit]

  • B. e. euphrosyne – Central Europe, Siberia
  • B. e. fingal (Herbst, 1804) – Northern Europe, Siberia
  • B. e. rusalka (Fruhstorfer, 1909) – Southern Europe, West Siberia
  • B. e. orphana (Fruhstorfer, 1907) – Transbaikalia, Amur, Ussuri
  • B. e. kamtschadalus (Seitz, [1909]) – Kamchatka, North Sakhalin
  • B. e. umbra (Seitz, [1909]) – Altai, Sayan
  • B. e. dagestanica (Sovinsky, 1905) – Caucasus, Transcaucasia
  • B. e. nephele (Herrich-Schäffer, [1847]) – Urals, Siberia

Foodplants and eggs[edit]

After mating, the female will lay her eggs on dead bracken (Pteridium aquilinum), or leaf litter near to violet plants – Common Dog–violet (Viola riviniana), Heath Dog–violet (Viola canina), Marsh Violet (Viola palustris). Sometimes they are laid on the leaves of the foodplant itself. They are laid singly, not in one large group such as the Marsh Fritillary. The mosaics that they prefer are typically one–third grass and two–-thirds bracken.

Eggs can be found on the foodplant from mid–May to the end of June. They are a pale yellow colour and can hatch after 10–14 days.

Caterpillar, pupa and adult[edit]

The emerging caterpillars begin feeding immediately and will moult three times within the first 5–6 weeks. Each caterpillar will then hibernate in a shrivelled leaf at the base of the plant, usually at the end of July. When they awaken the following March, they are half their previous size having shrunk during hibernation. After a period of feeding and growth, during which it moults one last time, the caterpillar is full size and ready to pupate. The chrysalis stage is formed amongst the leaf litter, and lasts just 10–14 days.

The adult butterfly flies between late April and June, being one of the earliest fritillaries to emerge. It will feed on the nectar from early spring flowers such as Bugle, Dandelion (Taraxacum officinale), and Lesser celandine.

There is a second brood during August.

Habitat[edit]

  • Woodland clearings, recently coppiced or clear-felled, with bracken, or leaf litter provided by oak and bramble
  • Well-drained habitats with mosaics of grass, bracken, and light scrub
  • Hot and freshly cut material
  • Abundant foodplants growing in short, sparse vegetation, where there is abundant dead plant material, bracken is preferred
  • Scrub edges can provide good breeding conditions, e.g., gorse

Management[edit]

  • A network of paths running through bracken to open the canopy, allows sunlight through to help germinate any violet foodplants. This can be achieved through grazing especially during winter and early spring. Cattle are better than sheep as their extra weight helps to trample and break up any dense standing dead stems. Also there is a risk that sheep tend to eat plants, (for example Ajuga reptans/Bugle), that provide nectar for the adult Pearl Bordered Fritillary. Another way of achieving this is by cutting and bruising the bracken, a proportion of the site at a time, during May and early June.
  • Burning can be useful for reducing the litter of bracken, although follow up management is required as extra bracken growth will be stimulated as a result. This will kill a proportion of invertebrates, and therefore only burning a proportion of the site, e.g., 20% is suggested.
  • Spraying can be useful for reducing high densitites bracken litter, but care should be taken to not severely reduce the density and allow the grass to develop, as this will harm the breeding habitat.
  • Woodlands create sunny clearings and rides, but avoid using clearings that are dominated by other plants such as Dogs Mercury (Mercurialis perennis), Common Bluebell, and vigorous grasses.

Example sites where found[edit]

See also[edit]

References[edit]

  1. ^ Nash, D.W. and Hardiman, D.M. 2013. A review of the Pearl-bordered Fritillary (Boloria euphrosyne L.)) in Ireland. Ir. Nat. J. 32: 132 - 137
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!