Articles on this page are available in 1 other language: Spanish (7) (learn more)

Evolution and Systematics

Functional Adaptations

Functional adaptation

Lack of wing scales enhances camouflage: clearwing butterfies
 

The wings of a clearwing butterfly provide camouflage because they lack scales, allowing whatever background the butterfly has landed on to show through its wings.

       
  "Some butterfly scales are modified into short spiky points, others into long, fine hairs. In some butterflies, especially those known as the clearwings, parts of the wing carry few or no scales, or scales reduced to tiny bristles. The effect of this is to camouflage the insect by allowing its background -- such as the flower on which it is feeding -- to show through the wings." (Foy and Oxford Scientific Films 1982:99-100)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Greta oto

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 44
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Greta oto

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 44 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCTGGATCTTTAATCGGAGAT---GATCAAATTAATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATGTTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTTTACCCCCTTCATTAATTCTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGTTGAACAGTGTACCCCCCACTTTCATCCAATATTGCACATGGAGGATCTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCCATTAATCTTATTACTACAATTATTAATATACGTATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTATGTATTACAGCTTTACTTTTATTATTATCTTTACCGGTATTAGCAGGAGCAATTACTATACTTTTAACTGATCGAAATTTAAATACTTCTTTTTTTGACCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGTNNNNNNNNNNTATATATTTTAATTTTACCAGGATTTGGTATAATTTCCCATATTATTTCACAAGAAAGAGGAAAAAAGGAAACTTTTGGATCTTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGGATAGATATTGATACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Greta oto

"Glasswing" redirects here. For the African glasswings, see Ornipholidotos. For the Australian glasswing, see Acraea andromacha.

The Glasswinged butterfly (Greta oto) is a brush-footed butterfly, and is a member of the subfamily Danainae, tribe Ithomiini, subtribe Godyridina.[1][2]

G. oto adults also exhibit a number of interesting behaviors, such as long migrations and lekking among males.

Description[edit]

The wings are transparent, with a span of 5.6 to 6.1 cm (2.2 to 2.4 in).[2] The butterfly's most common English name is glasswinged butterfly, and its Spanish name is "espejitos", which means "little mirrors". Indeed, the tissue between the veins of its wings looks like glass, as it lacks the colored scales found in other butterflies.[3] The opaque borders of its wings are dark brown, sometimes tinted with red or orange, and its body is dark in color.

Distribution[edit]

Adults range from Mexico through Panama and Colombia[2] They also fly through Florida.

Feeding[edit]

G. oto visits common flowers like lantana, but prefers to lay its eggs on plants of the tropical Solanaceae genus Cestrum.[2] The green caterpillars[4] feed on these toxic plants and are perhaps toxic to predators through secondary chemicals stored in their tissues; caterpillar chemical extracts are unpalatable to Paraponera clavata ants.[5] Adults are also assumed to be toxic,[6] but their toxicity results mainly from males feeding on flowers (e.g., Asteraceae) whose nectar contains pyrrolizidine alkaloids. These same alkaloids also are converted into pheromones by the males and used to attract females.

References[edit]

  1. ^ Lamas, G. (Ed.). (2004). Checklist: Part 4A. Hesperioidea - Papilionoidea. In: Heppner, J. B. (Ed.), Atlas of Neotropical Lepidoptera. Volume 5A. Gainesville, Association for Tropical Lepidoptera; Scientific Publishers.
  2. ^ a b c d Henderson, Carrol L. (2002). "Greta oto". Field guide to the Wildlife of Costa Rica. Austin, Texas: University of Texas Press. p. 56. ISBN 0-292-73459-X. OCLC 46959925. Retrieved 9 March 2009. 
  3. ^ Creation, Volume 30, No 4, page 56
  4. ^ Hill, S. K.. (1996). Behaviour and natural history of Greta oto in captivity (Lepidoptera: Nymphalidae: Ithomiinae), Tropical Lepidoptera, 7: 161-165.
  5. ^ Dyer, L. A. (1995). Tasty generalists and nasty specialists? Antipredator mechanisms in tropical lepidopteran larvae, Ecology, 76: 1483-1496.
  6. ^ Brown, K. S. (1984). Adult obtained pyrrolizidine alkaloids defend ithomiine butterflies against a spider predator, Nature, 309: 707-709.

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!