Overview

Brief Summary

Introduction

The African Queen is widespread in the Old World tropics, ranging from West Africa to Indonesia. Throughout much of its range it occurs in a number of sympatric polymorphic forms. It is replaced in Australia by D. petilia, raised to specific status by Lushai et al. (2005).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Summary

"Danaus chrysippus, also known as the Plain Tiger or African Monarch, is a common Asian and African butterfly that belongs to the Danainae subfamily of the brush-footed butterfly family. This meium sized, non-edible butterfly is mimicked by multiple species. Considered the archetypical Danaine of India, it is believed to be one of the first butterflies to be used in art. A 3500 year old Egyptian fresco in Luxor features the oldest illustration of this species."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Size: 70-80 mm. Characteristic pattern, with 3-4 spots in the middle of the upperside of the hindwing (closely mimicked by female Hypolimnas misippus, which has only one such spot).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Records

98 records. Latest in 2006 (many places)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

Widespread. AOO = 227 km2. EOO = 689,000 km2. 16 locations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Distribution

Widespread (All of tropical Africa, Asia and Australia)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"The Plain Tiger is a medium-sized butterfly with a wingspan of about 7–8 cm. The body is black with many white spots. The abdomen is yellowish above, whitish yellow. The wings are tawny the upper side being brighter and richer than the underside. Upper side: forewing tawny-red, paler over the dorsal area. Costa and apex black, the latter crossed by a white, oblique bar with two white spots below its lower end. One or two white spots above and beyond apex of cell and a series of terminal white spots varying in size. Hindwing: paler, termen narrowly black with a series of white spots. A black spot near the base of vein 2 and .some smaller black spots bordering the cell. Underside similar but paler. The male Plain Tiger is smaller than the female, but more brightly colored. In addition, male danaines have a number of secondary sexual characteristics. In the case of the Plain Tiger, these are: • The male has a pouch on the hindwing. This spot is white with a thick black border and bulges slightly. It is a cluster of specialised scent scales used to attract females. • The males possess two brush-like organs which can be pushed out of the tip of the abdomen. Egg: The egg is silvery white, shiny, tall, bullet-shaped with an apical point and ribbed sides. Caterpillar: Its uniformly cylindrical body is covered with bands of black and white interspersed with thick, yellow, dorso-lateral spots. The head is shiny, smooth and has alternating black and white semicircular bands. The legs and prolegs are black and the prolegs have white bands at their bases. It has 3 pairs of conspicuous long and black tentacle-like appendages on the 3rd, 6th and 12th segments. The first pair is moveable and also the longest. Pupa: Pupa is pale green with a smooth surface. When formed among dry or unnatural objects, the pupa body is pink in colour. The pupa is widest at the 7th abdominal segment where it has a double chain of extremely tiny golden and black beads. There are tiny golden spots on the shoulders and wing-cases."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

70-80 mm
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

"Three valid subspecies: (a) Danaus chrysippus chrysippus. Distribution - Asia, Mediterranean region, northern tropical Africa (b)Danaus chrysippus alcippus (Cramer, 1777) - formerly D. c. aegyptius. Morphology - Browner with broader white forewing spots. Distribution - From the Cape Verde Islands through tropical Africa to Yemen and Oman. (c) Danaus chrysippus orientis (Aurivillius, 1909) - formerly D. c. liboria. Morphology - Small white forewing spots. Distribution - Saint Helena, southern tropical Africa to South Africa, Madagascar, Comoros, Seychelles and Mascarenes. D. c. alcippus is close to becoming a distinct species."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

"The Plain Tiger is specifically mimicked by the following butterflies: • Indian Fritillary (Argyreus hyperbius) females • Danaid Eggfly (Hypolimnas misippus forma inaria) females. The following butterflies have a general resemblance common to both the Plain Tiger and the Common Tiger: • Leopard Lacewing (Cethosia cyane) males and females • Indian Tamil Lacewing (Cethosia nietneri mahratta) males and females • Common Palmfly (Elymnias hypermnestra) females All of these are examples of Batesian Mimicry since in all these cases, an edible species mimics an inedible species. The similarity between the Plain and Common Tigers, however, makes them Müllerian mimics, as the adverse experience a predator makes with either species will also protect the other."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

General Habitat

"Found in almost every habitat, including deserts, right up into the mountains till 9000 feet. Primarily a butterfly of open country and gardens. Least common in damp, forested, hilly regions."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

A somewhat migratory species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

"The Plain Tiger's larval host plants are from several families, most importantly Asclepiadoideae (Apocynaceae): • Asclepias – milkweeds (recorded on A.cancellata, A. coarctata, A. curassavica, A. fulva, A. kaessneri, A. lineolata, A. physocarpa, A. reflexa, A. scabrifolia, A. semilunata, A. stenophylla, A. swynnertonii, A.syriaca) • Aspidoglossum interruptum • Calotropis – mudar (recorded on C. gigantea, C. procera) • Caralluma burchardii (recorded from Canary Islands/Spain) • Cryptolepis buchananii • Cynanchum (recorded on C. abyssinicum, C. acutum, C. altiscandens, C. amplexicaule, C. carnosum, C. floribundum, C. sublanceolatum) • Gomphocarpus fruticosus • Kanahia laniflora • Leichardtia australis • Leptadenia hastata • Marsdenia leichhardtiana • Metaplexis japonica • Orbea variegata (recorded from Canary Islands/Spain) • Oxystelma pulchellum • Pentatropis (recorded on P. atropurpurea, P. quinquepartita • Pergularia daemia • Periploca linearifolia • Pleurostelma cernuum • Secamone (recorded on S. afzelii, S. parvifolia, S. platystigma • Stapelia gigantea • Stathmostelma (recorded on S. gigantiflorum, S. pedunculatum) • Tylophora (recorded on T. stenoloba, T. sylvatica) Host plants from other families include Dyerophytum indicum (Plumbaginaceae), Ficus (Moraceae; recorded on F. laevis, F. racemosa), Ipomoea (Convolvulaceae; recorded on I. alba, I. bona-nox), Lepisanthes rubiginosa (Sapindaceae) as well as some Euphorbiaceae, Malvaceae, Poaceae, Rosaceae and Scrophulariaceae."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Host-plants: prefers Calotropis procera, but feeds on any Asclepiadaceae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Abundant
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"Perhaps the commonest of Indian butterflies, the Plain Tiger is a familiar sight in every part of the Indian subcontinent. In its larval form, it sequesters plant poisons which the adults use to defend themselves against bird predators. Thus this species flies slowly and leisurely from dawn to dusk generally close to the ground and in a straight line. This gives its predators ample time to recognize and avoid attacking it. Inexperienced predators may try attacking it, but after the vomiting caused by the alkaloids in the butterfly, learn to keep away from it. To survive these occasional attacks, the butterfly has a tough, leathery skin. When attacked, it fakes death and oozes nauseating liquid which makes gives it a terrible smell and taste causing predators to release the butterfly quickly. Thus, the Plain Tiger has the ability to recover miraculously from predator attacks that would kill most other butterfly species. The Plain Tiger frequents gardens, sipping from flowers and, late in the day, fluttering low over bushes to find a resting place for the night. It basks, sitting close to the ground and spreading its wings with its back to the sun so that the wings are fully exposed to the sun's rays. As is usual with diurnal butterflies, it rests with its wings closed. Also reported to exhibit mud puddling."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

Strong flight, from dawn to dusk. Larva sequesters plant poisons and adult uses them to defend itself against bird predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

"Egg The female Plain Tiger perches on the upperside of a leaf and curling its abdomen around the edge, lays an egg on the underside. Only one egg is laid per leaf to avoid overcrowding of the caterpillars. Caterpillar After the caterpillar hatches, its first meal is the eggshell itself. It lives its entire larval life on the lower side of the leaves. In the first few days, it takes up a spot on the underside of the leaf and nips a complete circle around itself in the lower cuticle of the leaf. By doing this it stops the poisonous sap of its host plant from flowing into the area inside the circle. It then proceeds to eats the lower surface of this area, leaving the upper cuticle intact. As it grows, it eats both the lower and upper cuticle of the circle, leaving smallish circular holes in the leaves of its host plant. When its mandibles are large enough it eats the complete leaf by gnawing at the edges. Pupa The pupa hangs freely from the support."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Flight Period

June-September

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

"The Plain Tiger breeds throughout the year in India, except in the Himalayas where it is seasonal."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Danaus chrysippus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACGAATAAATAATATAAGATTTTGACTTTTACCCCCATCATTAATATTACTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACGGTTTACCCCCCCCTTTCATCTAATATTGCCCATAGAGGATCTTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTTTAAATATACGAATTAATAATATATCATTTGATCAAATATCTTTATTTGTTTGAGCAGTAGGTATTACAGCTCTTCTTTTATTACTATCATTACCTGTTTTAGCTGGGGCAATTACCATACTTCTTACTGACCGAAATCTAAATACTTCATTTTTCGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCAGGCTTTGGGATAATTTCCCATATTATTAGTCAAGAAAGAGGAAAAAAAGAAACTTTTGGATCACTAGGAATAATTTATGCAATAATAGCAATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTTGGAATAGATATTGACACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Danaus chrysippus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 72
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Common
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Resident and migrant

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN

Least Concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Abundance

Abundant

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Danaus chrysippus

Danaus chrysippus, also known as the Plain Tiger or African Monarch, is a common butterfly which is widespread in Asia and Africa. It belongs to the Danainae ("Milkweed butterflies") subfamily of the brush-footed butterfly family, Nymphalidae. It is a medium-sized, non-edible butterfly, which is mimicked by multiple species.

The Plain Tiger is believed to be one of the first butterflies to be used in art. A 3500-year-old Egyptian fresco in Luxor features the oldest illustration of this species.[1]

The Plain Tiger can be considered the archetypical danaine of India. Accordingly, this species has been studied in greater detail than other members of its subfamily occurring in India.

Description[edit]

Male Danaus chrysippus showing the pheromone pouch and brush-like organ in Kerala, India

The Danaus chrysippus is a medium-sized butterfly with a wingspan of about 7–8 centimetres (2.8–3.1 in). The body is black with many white spots. The wings are tawny, the upper side brighter and richer than the underside. The apical half of the forewing is black with a white band. The hindwing has three black spots around the center. The hindwing has a thin border of black enclosing a series of semicircular white spots.

Background color and extent of white on the forewings varies somewhat across the wide range; see Systematics and taxonomy below.

The male Plain Tiger is smaller than the female, but more brightly colored. In addition, male danaines have a number of secondary sexual characteristics. In the case of the Plain Tiger, these are:

  • The male has a pouch on the hindwing. This spot is white with a thick black border and bulges slightly. It is a cluster of specialised scent scales used to attract females.
  • The males possess two brush-like organs which can be pushed out of the tip of the abdomen.

Distribution[edit]

The range of the Plain Tiger extends from Africa and southern Europe, eastwards via Sri Lanka, India, and Myanmar to China, Java and Sulawesi. It is a very common species.

Systematics and taxonomy[edit]

Despite the external similarity, the Common Tiger is not closely related to this species. Three subspecies are considered valid in a 2005 review:[2]

Asia, Mediterranean region, northern tropical Africa
From the Cape Verde Islands through tropical Africa to Yemen and Oman. Browner with broader white forewing spots.
Saint Helena, southern tropical Africa to South Africa, Madagascar, Comoros, Seychelles and Mascarenes. Small white forewing spots.

D. c. alcippus is well on the way of becoming a distinct species.[2]

On the other hand, the former subspecies petilia is nowadays recognized as a good species, the Lesser Wanderer. More enigmatic[3] is the status of the former subspecies (or forms) dorippus and bataviana. These are tentatively also regarded as a distinct species, the "Dorippus Tiger" (Danaus dorippus).

However, it appears (from analysis of mtDNA sequences, which are only inherited from the mother) that the Dorippus Tiger is the product of an ancient lineage of Danaus hybridizing with Plain Tiger females.[2] As the Plain Tiger is known to be parasitized at least occasionally by Spiroplasma bacteria which selectively kill off male hosts,[4] a subsequent scarcity of Plain Tiger males might have led to this hybridization and the evolution of the Dorippus Tiger. From the color pattern of this species, it can be assumed that the ancient lineage had no black apex on the forewings, as this character is still absent in D. dorippus.

The presumed subspecies cratippus most likely belongs to either the Lesser Wanderer or the Dorippus Tiger, but confirmation of its taxonomic status requires more research. In any case, these three species are closely related; their closest relatives, in turn, might be the Soldier (D. eresimus) and Queen (D. gilippus) butterflies.[2]

Several local forms have been described from Asia:

The upper hindwing is more or less very white; about half of the individuals have a second submarginal spot in the forewing. Occasionally found in Southeast Asia, very rarely in India.
The upper hindwing has white markings. Occasionally found on Sulawesi.
The upper hindwing has a subapical band composed of somewhat larger spots, and an additional forewing spot as in f. alcippoides is always present. Found throughout the eastern parts of this subspecies' range.

On the other hand, the plethora of named taxa from Africa are apparently F1 or F2 hybrids between the Plain Tiger subspecies (the contact zone of which is in the general area of Uganda) and/or D. dorippus:

is D. c. chrysippus × D. c. alcippus
are D. c. alcippus × D. dorippus

Ecology[edit]

It is found in many habitats including desert (pending availability of food) and right up into the mountains at altitudes up to 9,000 feet (2,700 m). It is primarily a butterfly of open country and gardens and unlike the related Common Tiger, is least common in damp, forested, hilly regions. It is a somewhat migratory species.

This butterfly is perhaps the commonest of Indian butterflies and is a familiar sight on the subcontinent. It flies from dawn to dusk, frequenting gardens, sipping from flowers and, late in the day, fluttering low over bushes to find a resting place for the night.

As usual for diurnal butterflies, this species rests with its wings closed. When basking it sits close to the ground and spreads its wings with its back to the sun so that the wings are fully exposed to the sun's rays.

Defense against predators, mimicry[edit]

The Plain Tiger is protected from attacks due to the unpalatable alkaloids ingested during the larval stages. The butterfly therefore flies slowly and leisurely, generally close to the ground and in a straight line. This gives a would-be predator ample time to recognise and avoid attacking it. Inexperienced predators will try attacking it, but will learn soon enough to avoid this butterfly as the alkaloids in its body cause vomiting.

The butterfly also has a tough, leathery skin to survive such occasional attacks. When attacked it fakes death and oozes nauseating liquid which makes it smell and taste terrible. This encourages the predator to release the butterfly quickly. The Plain Tiger thus has the ability to recover "miraculously" from predator attacks that would kill most other butterflies.

The protection mechanisms of the Plain Tiger, as of the other danaines, and indeed of all colorful unpalatable butterflies, result in predators learning this memorable aspect at first hand. Predators soon associate the patterns and habits of such butterfly species with unpalatability to avoid hunting them in future. This advantage of protection has led to a number of edible butterfly species, referred to as "mimics", evolving to resemble inedible butterflies, which are referred to as the "model". The resemblance is not only in color, shapes, and markings, but also in behavioural and flight patterns. This form of mimicry—where an edible species mimics an inedible species—is known as Batesian mimicry.

The mimics can resemble the models very closely. In some cases, it requires examination in the hand and reference to field guides to tell them apart. The Plain Tiger is specifically mimicked by the following butterflies:

The following butterflies have a general resemblance to both the Plain Tiger and the Common Tiger:

The similarity between the Plain and Common Tigers makes them Müllerian mimics, as the adverse experience a predator makes with either species will also protect the other.

Life history[edit]

The Plain Tiger breeds throughout the year in India, except in the Himalayas where it is seasonal. This presumably applies to the other tropical and subtropical parts of its range too.

Egg

The female Plain Tiger perches on the upperside of a leaf and, curling its abdomen around the edge, lays an egg on the underside. Only one egg is laid per leaf to avoid overcrowding of the caterpillars. The egg is silvery white, shiny, tall, bullet-shaped with an apical point and ribbed sides.

Old caterpillar on a Calotropis milkweed species in Hyderabad, India
Plain Tiger caterpillar making "moat" to feed during the first instar
Larva at butterfly garden, Central Park (Kolkata)
Caterpillar

After the caterpillar hatches, its first meal is the eggshell itself. It lives its entire larval life on the lower side of the leaves. During the first few days it has a very interesting manner of feeding: It will take up a spot on the underside of the leaf and nip a complete circle around itself in the lower cuticle of the leaf. By doing this it stops the poisonous sap of its host plant from flowing into the area inside the circle. It then proceeds to eats the lower surface of this area, leaving the upper cuticle intact.

As it grows, it eats both the lower and upper cuticle of the circle thus leaving smallish circular holes in the leaves of its host plant. When its mandibles are large enough it eats the complete leaf by gnawing at the edges.

The caterpillar is uniformly cylindrical. Its body is covered with bands of black and white interspersed with thick, yellow, dorsolateral spots. The most striking characteristics are the three pairs of long and black tentacle-like appendages. The first pair is moveable and also the longest. The tentacles are present on the third, sixth and twelfth segments. The head is shiny, smooth and has alternating black and white semicircular bands. The legs and prolegs are black and the prolegs have white bands at their bases.

Pupa

The pupa hangs freely from the support. It is widest at the seventh abdominal segment where it has a double chain of extremely tiny golden and black beads. There are tiny golden spots on the shoulders and wing-cases. The rest of the pupa is pale green with a smooth surface. The pupa is light pink when formed among dry or unnatural objects.

Larval food plants[edit]

The Plain Tiger's larval host plants are from several families,[5] most importantly Asclepiadoideae (Apocynaceae):

Host plants from other families include Dyerophytum indicum (Plumbaginaceae), Ficus (Moraceae; recorded on F. laevis, F. racemosa), Ipomoea (Convolvulaceae; recorded on I. alba, I. bona-nox), Lepisanthes rubiginosa (Sapindaceae) as well as some Euphorbiaceae, Malvaceae, Poaceae, Rosaceae and Scrophulariaceae.

Footnotes[edit]

  1. ^ Larsen (1994)
  2. ^ a b c d Smith et al. (2005)
  3. ^ See Smith et al. (2005)
  4. ^ Jiggins et al. (2000)
  5. ^ HOSTS (2007)

See also[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!