Ypthima baldus — Details

Common Five-ring learn more about names for this taxon

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Ypthima balda

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Barcode data: Ypthima baldus

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCCCTCAGTCTTATTATTCGAACAGAATTAGGAACCCCTAGTTCCCTAATTGGAGAT---GACCAAATTTATAACACAATTGTGACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCCCTAATACTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCTCCATCCTTAATACTTTTAATTTCTAGCAGCCTTGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCACTTTCATCTAATATTGCCCATAGAGGCTCATCTGTAGATTTAGCAATTTTCTCCCTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCCATTAATTTTATTACAACTATTATTAATATACGAATTAATAACATATCTTATGATCAATTACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTATTACTTTCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTATATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATTATTTCTCAAGAAAGAGGTAAAAAAGAAACTTTTGGGTATTTAGGGATAATCTATGCAATACTAGCTATTGGATTATTAGGATTCATTGTTTGAGCCCATCATATATTTACTGTAGGAATAGATATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Ypthima baldus

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Ypthima baldus

Learn more about this article

Common Five-ring (Ypthima baldus) in wet season in Kolkata, West Bengal, India.

The Common Fivering Ypthima baldus is a species of Satyrinae butterfly found in Asia.

Contents

Description

See glossary for terms used

Wet-season form

in wet season at Narendrapur near Kolkata, India

Male: Upperside brown, both fore and hind wing with terminal margins much darker, and generally with more or less distinct subbasal and discal dark bands. Fore wing with a large, slightly oblique, oval, bi-pupilled, yellow-ringed black, pre-apical ocellus. Hind wing with two postdiscal, round, uni-pupilled, similar but smaller ocelli, and very often one or two minute tornal ocelli also.

Underside similar to the underside in Y. philomela but the ochraceous-white ground-colour paler, tin-transverse brown strice coarser, the ocelli on the hind wing more distinctly in echelon, two tornal, two median, and two pre-apical, and on both fore and hind wing more or less distinctly defined, subbasal, discal and subterminal brown transverse bands.

Female: Differs on the upperside in having the area surrounding or bordering the ocelli on both fore and hind wing paler, closely irrorated with brown striae, the discal transverse band generally clearly defined, and very often both the tornal, and at least one of the apical, ocelli distinct. On the underside it is paler than the male, and has the subbasal, discal and subterminal transverse dark bands more clearly defined.[1]

Dry-season form

Dry season form on Mikania micrantha (Bittervine/ Mile-a-minute/ American rope/ Chinese creeper) in Kolkata, West Bengal, India.
Dry season form in Kolkata, West Bengal, India.

Males and females:Upperside very similar to the above, paler; in the female often the ground-colour ochraceous white, closely irrorated with brown striae ; ocelli as in the wet-season form, but those on the hind wing often non-pupilled. Underside also paler than in the wet-season form, the subbasal, discal and subterminal bands on the whole more prominent; ocelli on the hind wing reduced to mere specks.[1]

Wing expanse of 38-46 mm.

Distribution

Sub-Himalayan India from Chamba to Sikkim and Bhutan. Central India and the hills of southern India and the Western Ghats. Assam, Myanmar and the Tenasserim.[1]

Gallery

This section looks like an image gallery. Wikipedia policy discourages galleries of random images of the article subject; please improve or remove the section accordingly, moving freely licensed images to Wikimedia Commons if not already hosted there. (May 2010)

References

  1. ^ a b c Bingham, C. T. 1905. Fauna of British India. Butterflies. Volume 1
Stub iconThis Satyrinae article is a stub. You can help Wikipedia by expanding it.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!