Physical Description

Type Information

Syntype for Battaristis concinusella (Chambers, 1875)
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;
Preparation: Pinned
Locality: Texas, United States
  • Syntype: 1875. Cincinnati Quarterly Journal of Science. 2: 253.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Battaristis concinusella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTCTTAGATTATTAATTCGAGTAGAACTAGGAAATCCAGGACAATTAATTGGTAATGACCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAACTTTACTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGCTGAACAGTTTACCCCCCTCTATCCTCTAATATTGCCCATGGAGGTAGATCTGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCTTTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACCGCTTTACTTCTTCTTCTTTCTCTTCCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCTTTTTTCGACCCAGCTGGTGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Battaristis concinusella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Battaristis concinusella

Battaristis concinusella is a species of moth in the Gelechiidae family. It is found in North America, including California, Delaware, Illinois, Maryland, Minnesota, North Dakota, Ohio, Ontario, Quebec, South Carolina and West Virginia.[1]

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!