Overview

Comprehensive Description

Biology

Common in bays, muddy and rocky areas and kelp beds, also in estuaries (Ref. 36497). Form schools. Adults feed on zooplankton (Ref. 9273), while juveniles feed on algae and kelp fly larvae (Ref. 4930). Demersal spawner in nearshore habitats (Ref. 56049). Oviparous, with planktonic, primarily neustonic larvae (Ref. 36497). Eggs are attached to spawning substrate and to one another by adhesive filaments (Ref. 36497).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: silverside (English), pejerrey (Espanol)
 
Atherinops affinis (Ayres, 1860)

Topsmelt silverside

Head pointed, compressed; tip of snout broadly rounded, extending a little beyond mouth; mouth small, extendible, opens at front; top lip folded down; eye small (~ ½ snout length); anal origin under rear of first dorsal; gill rakers rounded, without serrations on inner surface, 20-25; jaw teeth with forked tips, in single row; 1st  dorsal V-IX spines, origin over or a little behind anus; last ray of 2nd  dorsal over last 3 rays of anal; pelvics inserted a little closer to anus than top corner of pectoral base; pectorals reach to pelvic origin; two rows of scales under eye; 5-8 scales between two dorsal fins.


Green back, bright stripe on flank, silvery below.

Size: 37 cm.

Habitat: coastal bays, over muddy bottoms and algal beds.

Depth: 0-26 m.

Temperate eastern Pacific; Canada to southern Baja and the upper Gulf of California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Vancouver Island in British Columbia, Canada to Baja California, Mexico and the Gulf of California.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found from Canada to Baja California, and the upper Gulf of California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: southern Canada to Gulf of California,
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (F) - 26 (F)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 10; Dorsal soft rays (total): 8 - 14; Analspines: 1; Analsoft rays: 19 - 25; Vertebrae: 44 - 52
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 37.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 370 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

37.0 cm TL (male/unsexed; (Ref. 9273)); max. reported age: 9 years (Ref. 72477)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Blue gray to green above, silvery below; a striking silver band bordered above with blue extends the full length of the body (Ref. 6885). Branchiostegal rays: 5-6 (Ref. 36497).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Atherinops oregonia
Catalog Number: USNM 74762
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): R. Clanton
Locality: Yahuto Bay, Oregon
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in marine and brackish waters (Robertson and Allen 2002) down to depths of 26m. This species is commonly found in bays, muddy and rocky areas and kelp beds, and is also common in estuaries (Watson 1996). Adults feed on zooplankton (Lavenberg 1995), while juveniles feed on algae, kelp, and fly larvae (Fitch, J.E. and R.J. Lavenberg 1975). Juvenile and adults will move into shallow waters and feed on the bottom (Emmett 1991). This fish is a demersal spawner in nearshore habitats (Shanks 2005) that is oviparous, with planktonic, primarily neustonic larvae (Watson 1996). Eggs are benthic, larvae are planktonic, and juveniles and adults are schooling pelagic fish. Eggs are attached to spawning substrate and to one another by adhesive filaments (Watson 1996). Eggs are laid primarily on eelgrass (Zostera spp.) and adhere to macroalgae on tidal flats. Larvae are often found over soft, unconsolidated sediments and other substrates. Juveniles and adults occur along sandy beaches, in kelp beds, over rocky reefs, and around piers (Emmett 1991).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 59 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 0.61 - 8
  Temperature range (°C): 17.687 - 21.311
  Nitrate (umol/L): 0.133 - 0.334
  Salinity (PPS): 33.668 - 34.249
  Oxygen (ml/l): 5.074 - 5.498
  Phosphate (umol/l): 0.352 - 0.426
  Silicate (umol/l): 3.264 - 3.551

Graphical representation

Depth range (m): 0.61 - 8

Temperature range (°C): 17.687 - 21.311

Nitrate (umol/L): 0.133 - 0.334

Salinity (PPS): 33.668 - 34.249

Oxygen (ml/l): 5.074 - 5.498

Phosphate (umol/l): 0.352 - 0.426

Silicate (umol/l): 3.264 - 3.551
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Surface, Near Surface, Water column only

Habitat: Estuary, Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Planktivore

Diet: phytoplankton, zooplankton, pelagic fish eggs, pelagic fish larvae, Insects
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 36497).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Benthic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Atherinops affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGGACTGCTTTAAGCCTCCTAATTCGAGCTGAACTTAGCCAACCAGGCTCTCTCCTAGGAGACGACCAGATTTATAATGTAATCGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTCGGAAACTGACTAATTCCCCTTATGATCGGGGCCCCTGATATGGCTTTCCCTCGAATAAATAACATGAGCTTTTGACTCCTTCCCCCCTCATTCCTGCTTCTCCTGGCTTCTTCAGGAGTAGAAGCAGGTGCTGGTACCGGATGAACAGTTTACCCCCCTCTATCCGGCAATCTAGCCCACGCCGGGGCGTCTGTAGACTTAACTATTTTCTCCCTCCACTTAGCAGGTGTTTCATCAATTCTAGGTGCCATTAATTTCATTACCACAATTATCAACATGAAACCTCCCGCGATTTCACAATATCAAACCCCCCTCTTCGTATGGGCCGTCCTAATTACCGCCGTACTTCTTCTTCTATCCCTTCCCGTCCTTGCTGCTGGAATCACTATGCTTCTAACTGACCGAAACCTAAATACCACCTTCTTTGACCCTGCTGGAGGAGGAGACCCCATTCTTTATCAACACTTATTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Atherinops affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Iwamoto, T., Eschmeyer, W., Smith-Vaniz, B., Alvarado, J.

Reviewer/s
Carpenter, K., Polidoro, B., Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species has a wide distribution in the Eastern Pacific, occurs in at least a few marine protected areas, and there are no known major threats. Therefore, this species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is considered to be a common species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats to this species. However, this species is found in commercial fisheries and is also taken by sport fishermen.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species' distribution includes a number of Marine Protected Areas in the eastern Pacific region (WDPA 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Atherinops affinis

Atherinops affinis, the topsmelt silverside or simply topsmelt, is a species of Neotropical silverside native to the eastern Pacific Ocean. This fish is found along the west coast of North America from southern British Columbia to Baja California. It is marine and it often schools in relatively shallow water such as estuaries, bays, rocky intertidal zones and kelp forests, where it feeds on zooplankton. This is a common fish of the San Francisco Bay and Sacramento-San Joaquin River Delta in California. The topsmelt is silver, with a shiny silver lateral band running its length, and blue or green coloration dorsally.. Their gills are a golden-yellow. The eyes of the topsmelt are small and beady. Its top lip is folded down. Topsmelts have long pectoral fins compared to other fish. On the jaw of the topsmelt are pointy, small teeth. It is edible and may be fished recreationally. It is the only known member of its genus.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!