Ecology

Associations

Flowering Plants Visited by Sarcophaga spp. in Illinois

Sarcophaga spp. Meigen: Sarcophagidae, Diptera
(observations are from Graenicher and Anderson & Hill)

Asteraceae: Aster laevis sn/fp (Gr), Aster lateriflorus sn/fp (Gr), Aster macrophyllus sn/fp (Gr), Aster prenanthoides sn/fp (Gr), Cirsium arvense sn/fp (Gr), Conyza canadensis sn/fp (Gr), Erigeron annuus sn/fp (Gr), Leucanthemum vulgare sn/fp (Gr), Solidago canadensis sn/fp (Gr), Solidago juncea sn/fp (Gr), Tanacetum vulgare sn/fp (Gr); Caprifoliaceae: Symphoricarpos occidentalis sn/fp (Gr); Celastraceae: Euonymus atropurpureus sn/fp (Gr); Hamamelidaceae: Hamamelis virginiana sn/fp (AH); Liliaceae: Smilacina racemosa fp/exp (Gr), Smilacina stellata sn/fp (Gr); Smilacaceae: Smilax ecirrhata sn/fp (Gr), Smilax herbacea sn/fp (Gr), Smilax tamnoides hispida sn/fp (Gr)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / pathogen
Entomophthora bullata infects adult of Sarcophaga

Animal / parasitoid / endoparasitoid
larva of Eucoila crassinerva is endoparasitoid of larva of Sarcophaga

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Sarcophaga (Sarcophaga sp. A) is prey of:
Saprinus
Aleochara curtula
Alysia manducator
Metacantharis clypeata
Harpalus rufipes
Pterostichus niger
Creophilis maxillosus
Thereva
Nabis lativentris
Necrophorus humator
Necrophorus vespillo
Thanotophilus rugosus
Thanotophilus sinuatus
Ptomophagus subvillosus
Catops fuscus
Catops kirbii
Saprinus semistriatus
Hister striola
Hister cadaverinus
Hister carbonarius
Hydrotaea armipes
Sphaeridium scarabaeoides
Xyalophora quinquelineata
Platystethus americanus
Staphylinidae
Philonthus
Aleochara
Philonthus cruentatus
Aleochara bipustulata
Macrocheles
Parasitus
Uropodidae
Acaridae
Hyponigrus obsidianus
Cothonas

Based on studies in:
USA: North Carolina (Forest, Plant substrate)
England (Carrion substrate)
USA: Illinois (Dung)
USA: New York (Dung)

This list may not be complete but is based on published studies.
  • H. E. Savely, 1939. Ecological relations of certain animals in dead pine and oak logs. Ecol. Monogr. 9:321-385, from pp. 335, 353-56, 377-85.
  • I. Valiela, 1974. Composition, food webs, and population limitation in dung arthropod communities during invasion and succession. Am. Midl. Nat. 92:370-385, from p. 379.
  • I. Valiela, 1974. Composition, food webs, and population limitation in dung arthropod communities during invasion and succession. Am. Midl. Nat. 92:370-385, from p. 380.
  • R. F. Chapman and J. H. P. Sankey, 1955. The larger invertebrate fauna of three rabbit carcasses. J. Anim. Ecol. 24:395-402, from p. 400.
  • C. O. Mohr, 1943. Cattle droppings as ecological units. Ecol. Monogr. 13:276-298, from p. 282.
  • I. Valiela, 1969. An experimental study of the mortality factors of larval Musca autumnalis DeGeer. Ecol. Monogr. 39:199-225, from p. 225.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Sarcophaga (Sarcophaga sp. A) preys on:
Monochammus titillator
Leporidae
dung

Based on studies in:
USA: North Carolina (Forest, Plant substrate)
England (Carrion substrate)
USA: Illinois (Dung)
USA: New York (Dung)

This list may not be complete but is based on published studies.
  • H. E. Savely, 1939. Ecological relations of certain animals in dead pine and oak logs. Ecol. Monogr. 9:321-385, from pp. 335, 353-56, 377-85.
  • I. Valiela, 1974. Composition, food webs, and population limitation in dung arthropod communities during invasion and succession. Am. Midl. Nat. 92:370-385, from p. 379.
  • I. Valiela, 1974. Composition, food webs, and population limitation in dung arthropod communities during invasion and succession. Am. Midl. Nat. 92:370-385, from p. 380.
  • R. F. Chapman and J. H. P. Sankey, 1955. The larger invertebrate fauna of three rabbit carcasses. J. Anim. Ecol. 24:395-402, from p. 400.
  • C. O. Mohr, 1943. Cattle droppings as ecological units. Ecol. Monogr. 13:276-298, from p. 282.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sarcophaga sp. GC1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sarcophaga sp. S102

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CAACAATGGTTATTCTCTACTAATCATAAAGATATTGGAACTTTATACTTTATTTTCGGAGCTTGAGCAGGAATAGTAGGAACTTCACTAAGAATTTTAATTCGAGCAGAATTAGGTCACCCAGGCGCACTAATTGGTGAT---GATCAAATTTATAATGTAATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTAATACCTATCATAATTGGAGGATTTGGAAACTGATTAGTACCAATTATACTAGGAGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCTCCTGCACTAACATTACTTCTAGTAAGCAGTATAGTAGAAAATGGGGCTGGAACAGGATGAACTGTCTATCCTCCATTATCATCCAACATTGCTCATGGAGGGGCTTCCGTAGATTTAGCTATTTTCTCACTTCATTTAGCAGGAATTTCTTCAATTTTAGGGGCAGTTAATTTTATTACTACAGTAATTAATATACGATCAACAGGTATTACCTTTGATCGAATACCTTTATTCGTATGATCAGTAGTGATTACAGCTCTATTATTATTACTTTCTTTACCTGTATTAGCTGGAGCAATTACTATGTTACTAACAGACCGAAATATTAATACGTCATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTTTATACCACCATTTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCACATTATTAGCCAAGAATCAGGTAAAAAGGAAACATTTGGATCCTTAGGAATAATCTATGCTATATTAGCAATTGGTCTTTTAGGATTTATTGTATGAGCTCATCATATATTTACTGTAGGAATAGACGTAGATACACGAGCCTATTTCACTTCAGCGACAATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTAGTTGACTTGCTACTCTTTATGGAACT---CAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sarcophaga sp. S102

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sarcophaga sp. S134

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CAACAATGGTTATTCTCTACTAATCATAAAGATATTGGAACTTTATACTTTATTTTCGGAGCTTGGGCAGGAATAGTAGGAACTTCACTAAGAATTTTAATTCGAGCAGAATTAGGTCACCCAGGTGCACTAATTGGTGAT---GATCAAATTTATAATGTAATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTAATACCTATCATAATTGGAGGATTTGGAAACTGATTAGTACCAATTATACTAGGAGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCTCCTGCACTAACATTACTTCTAGTAAGCAGTATAGTAGAAAATGGGGCTGGAACAGGATGAACTGTCTATCCTCCATTATCATCCAACATTGCTCATGGAGGAGCTTCCGTAGATTTAGCTATTTTCTCACTTCATTTAGCAGGAATTTCTTCAATTTTAGGGGCAGTTAATTTTATTACTACAGTAATTAATATACGATCAACAGGTATTACCTTTGATCGAATACCTTTATTCGTATGATCAGTAGTGATTACAGCTCTATTATTATTACTTTCTTTACCTGTATTAGCTGGAGCAATTACTATGTTACTAACAGACCGAAATATTAATACGTCATTCTTTGACCCAGCCGGAGGAGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCACATTATTAGCCAAGAATCAGGTAAAAAGGAAACATTTGGATCCTTAGGAATAATCTATGCCATATTAGCAATTGGTCTTTTAGGATTTATTGTATGAGCTCATCATATATTTACTGTAGGAATAGACGTAGATACACGAGCCTATTTCACTTCAGCAACAATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTAGTTGACTTGCTACTCTTTATGGAACT---CAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sarcophaga sp. S134

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 1466
Specimens with Sequences: 1463
Specimens with Barcodes: 1358
Species: 135
Species With Barcodes: 133
Public Records: 1074
Public Species: 129
Public BINs: 126
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sarcophaga

Sarcophaga is a genus of true flies, the type of the flesh-fly family (Sarcophagidae).

This genus occurs essentially worldwide. These flies are generally well-sized and of a greyish color; like many of their relatives, the typical patterns are lengthwise darker stripes on the thorax and dark and light square dots on the abdomen. Many have conspicuous red compound eyes. These are set further apart in females than in males; the females are also larger on average. As typical for this family, it is almost impossible to tell the species apart from their outward appearance, and many can only be reliably identified by microscopic examination of the males' genitalia.

As the common name implies, their larvae typically feed on decaying meat. Some, however, rather eat the bacteria and other small organisms living on carrion. Many species have adapted to humans, and while they are usually nuisance pests, some are medically significant vectors of pathogens and bacteria. Sometimes, the larvae cause myiasis. Others are parasitoids of pest caterpillars and beneficial in forestry and orchards.

Well-known species are Sarcophaga africa, Sarcophaga bercaea, the grey flesh-fly Sarcophaga bullata, Sarcophaga carnaria, Sarcophaga crassipalpis, the friendly fly Sarcophaga aldrichi and the red-tailed flesh-fly Sarcophaga haemorrhoidalis.

Subgenera[edit]

The immense number of Sarcophaga species is divided among the following subgenera, some of which are occasionally considered (and may well be) distinct genera:

References[edit]

  1. ^ a b J. M. Aldrich (1916; reprinted 2009). Sarcophaga and allies in North America. BiblioBazaar. ISBN 978-1-115-40881-3.  [page needed]

Further reading[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!