Overview

Brief Summary

Erebia sudetica is a satyrine butterfly endemic to the mountains of Central and Eastern Europe. It has a highly patchy distribution at high elevations in the Massif Central (South-central France), the French and Swiss Alps, the Sudety Mountains of Poland and the Czech Republic, and the Carpathians of Romania (Kudrna 2002). The butterflies are found in alpine and subalpine meadows where the caterpillars feed on grasses (Sonderegger 1996, 2005). Several subspecies are recognized, and a series of studies have investigated the population genetics and ecology of this species (Cupedo 1996, Cuvelier & Dincă 2007, Habel et al. 2010, Haubrich & Schmitt 2007, Konvička et al. 2010, Kuras et al. 2001a,b, 2003, Schmitt 2009). Erebia sudetica was listed in Appendix II of the Bern Convention (Council of Europe 1979). Most populations are threatened due to changes in land use (Lepidopterologen-Arbeitsgruppe 1987, Sonderegger 1996, van Swaay et al. 2012, Wermeille et al. 2007).

  • Council of Europe (1979) Convention on the Conservation of European Wildlife and Natural Habitats. [Text of Convention]
  • Cupedo F (1996) Die morphologische Gliederung des Erebia melampus-Komplexes, nebst Beschreibung zweier neuer Unterarten: Erebia melampus semisudetica ssp.n. und Erebia sudetica belladonnae ssp.n. (Lepidoptera, Saryrinae). Nota lepidopterologica, 18: 95-125.
  • Cuvelier S, Dincă V (2007) New data regarding the butterflies (Lepidoptera: Rhopalocera) of Romania, with additional comments (general distribution in Romania, habitat preferences, threats and protection) for ten localized Romanian species. Phegea 35(3):93-115.
  • Habel JC, Ivinskis P, Schmitt T (2010) On the limit of altitudinal range shifts – Population genetics of relict butterfly populations. Acta Zoologica Academiae Scientiarum Hungaricae 56(4):383–393.
  • Haubrich K, Schmitt T (2007) Cryptic differentiation in alpine-endemic, high-altitude butterflies reveals down-slope glacial refugia. Molecular Ecology 16(17):3643–3658.
  • Konvička M, Benes J, Schmitt T (2010) Ecological limits vis-à-vis changing climate: Relic Erebia butterflies in insular Sudeten mountains. Pages 341-355 in Relict Species: Phylogeography and Conservation Biology. Habel JC, Assmann T, eds. Springer Verlag, Berlin, Heidelberg.
  • Kudrna O (2002) The distribution atlas of European butterflies. Oedippus, 20:1–342.
  • Kuras T, Beneš J, Fric Z, Konvička M (2003) Dispersal patterns of endemic alpine butterflies with contrasting population structures: Erebia epiphron and E. sudetica. Population Ecology 45: 115-123. doi: 10.1007/s10144-003-0144-x
  • Kuras T, Beneš J, Konvička M (2001a) Behaviour and within-habitat distribution of adult Erebia sudetica sudetica, endemic of the Hrubý Jeseník Mts., Czech Republic (Nymphalidae, Satyrinae). Nota lepidopterologica 24: 69-83.
  • Kuras T, Beneš J, Konvička M, Honc L (2001b) Life histories of Erebia sudetica sudetica and E. epiphron silesiana with description of immature stages. Atalanta 32: 187-196.
  • Lepidopterologen-Arbeitsgruppe (1987) Tagfalter und ihre Lebensräume: Arten, Gefährdung, Schutz. Schweizerischer Bund für Naturschutz, Basel, 516 pp.
  • Schmitt T (2009) Biogeographical and evolutionary importance of the European high mountain systems. Frontiers in Zoology 2009, 6:9. doi:10.1186/1742-9994-6-9
  • Sonderegger P (1996). Erebia sudetica, Staudinger, 1861. Pages 113-114 in Background Information on Invertebrates of the Habitats Directive and the Bern Convention. van Helsdingen PJ, Willemse L, Speight MCD, eds. Strasbourg, Council of Europe Publishing.
  • Sonderegger P (2005) Die Erebien der Schweiz. Selbstverlag, Biel/Bienne, Switzerland.
  • van Swaay C, Collins S, Dušej G, Maes D, Munguira M, Rakosy L, Ryrholm N, Šašić M, Settele J, Thomas J, Verovnik R, Verstrael T, Warren M, Wiemers M, Wynhoff I (2012) Dos and Don’ts for butterflies of the Habitats Directive of the European Union. Nature Conservation 1: 73-153. doi: 10.3897/natureconservation.1.2786
  • Wermeille E, Sonderegger P, Carron G (2007) Aktionsplan Nr. 14 - Sudeten-Mohrenfalter (Erebia sudetica). Swiss Butterfly Conservation, 53 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This is a European species that occurs very locally in widely separated areas: in France in the Massif Central (Monts du Cantal) and the Alps (Savoie and Isère), in central Switzerland (Grindelwald), in Czech Republic (Sudeten) and in Romania in three places in the Carpathians. Its elevational range is 1,200-2,000 m. This is a European endemic species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Sudeten Ringlet occurs on alpine and sub-alpine grasslands, especially those near the tree-line. They are most numerous on damp grasslands with tall grasses and flowering plants, but they also reproduce on dry grassland. Although Sweet Vernal-grass (Anthoxanthum odoratum) is probably the most important foodplant, other grasses, such as Annual Meadow-grass (Poa annua), are also used. It has one generation a year and passes the winter as a caterpillar. Habitats: alpine and subalpine grasslands (37%), coniferous woodland (25%), mixed woodland (12%), inland cliffs and exposed rocks (12%), mesophile grasslands (12%).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Erebia sudetica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATACTTTATTTTTGGAATTTGAGCAGGTATAATAGGAACATCCCTTAGTCTTATTATTCGTACAGAATTAGGTAACCCCGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTATCCCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTCTGACTTCTCCCCCCCTCTTTAGTTTTATTAATTTCAAGTAGTATCGTAGAAAATGGTGCTGGCACAGGATGAACGGTTTATCCCCCCCTTTCATCCAATATTGCCCATAGTGGATCTTCTGTTGATTTAGCAATTTTCTCCTTACATTTAGCTGGAATTTCATCAATTCTCGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCTTATGATCAAATACCCCTATTTGTTTGAGCTGTAGGAATTACTGCATTATTATTATTACTCTCCTTACCTGTATTAGCAGGAGCTATTACAATACTTCTTACAGATCGAAATTTAAATACTTCTTTTTTTGACCCCGCAGGAGGTGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Erebia sudetica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2c

Version
3.1

Year Assessed
2010

Assessor/s
van Swaay, C., Wynhoff, I., Verovnik, R., Wiemers, M., López Munguira, M., Maes, D., Sasic, M., Verstrael, T., Warren, M. & Settele, J.

Reviewer/s
Lewis, O. (Butterfly RLA) & Cuttelod, A. (IUCN Red List Unit)

Contributor/s

Justification
This is a local species with scattered populations in Europe. Population declines have been reported in Switzerland and Romania. In Romania there are two distinct populations: a large one in the Eastern Carpathians (Rodna) and one in the Southern Carpathians (Retezat), which seems to be on the brink of extinction. In Poland the situation is unclear, and it is not known if the species maintains a resident population at the moment. It is considered that both in Europe and the EU-27 countries the species has declined by more than 30%. Therefore it is classified as Vulnerable.

History
  • 2000
    Vulnerable
  • 1996
    Not Evaluated
    (Baillie and Groombridge 1996)
  • 1996
    Not Evaluated
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The Sudeten Ringlet is a local species, restricted to (semi-) natural areas. It is reported extinct in Poland. Strong declines in distribution or population size of more than 30% have been reported from Romania. Declines in distribution or population size of 6-30% have been reported from Switzerland. Populations are more or less stable in France. In Czech Republic, there is a (quite strong) range decline, but the population size appears to be stable (Eionet 2010).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The main threats are intensified grazing and abandonment. Considering its limited distribution, the Sudeten Ringlet may become threatened in the long term by climate change. As the species is not treated in the Climatic Risk Atlas (Settele et al. 2008) there is no information on the possible change of the climate envelope.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed on the Habitats Directive Annex 4 and Bern Convention Annex 2. More research is needed on the distribution and ecology of the species. Suitable habitats should be protected and appropriately managed. The effects of conservation actions should be monitored by a Butterfly Monitoring Scheme. In the Czech Republic, Poland and Romania, the species only occurs in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sudeten Ringlet

The Sudeten Ringlet (Erebia sudetica) is a species of butterfly in the Nymphalidae family. It is found in Czechia, Poland, Romania, France, and Switzerland. Its natural habitat is temperate grassland. It is threatened by habitat loss.

Biology[edit]

The larvae feed on various grasses. Of these, Anthoxanthum odoratum is probably the most important foodplant, but other grasses, such as Poa annua, are also used. There is one generation per year. The species passes the winter in the larval stage.[2]

References[edit]

  1. ^ http://www.iucnredlist.org/apps/redlist/details/39492/0
  2. ^ C. Van Swaay et al. (2012). "Dos and Don'ts for butterflies of the Habitats Directive of the European Union". Nature Conservation 1: 73. doi:10.3897/natureconservation.1.2786. 

Sources[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!