Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) It is distributed broadly across northern and central North America from extreme southern British Columbia and north-central Alberta (noticeably absent from the Yukon) east to Newfoundland and Nova Scotia and New England, south to California, Nevada, Colorado, Nebraska, Indiana, Iowa and Virginia; and spotty in the west in southern Washington and east of the Cascade Mountains (Cannings, 2003; Nikula et al., 2003; Paulson, 1999; Westfall and May, 1996; Paulson and Dunkle, 2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs in eight provinces and one territory in Canada and twenty eight states in the United States of America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

The first antennal segment equal to or longer than succeeding 6 segments together; labium (ligula) with a deep, open, median cleft. Labium cleft only to base of palpal lobes. Gills long and slender with many thin marginal hairs, but no stiff setae along the gill margins; common statewide on shady streams. Median gill without stout spines, only thin, short setae and few long hair-like setae along margins; no stout spines on posterior portion of lateral carinae of sbdominal segments 9 and 10. Very early instars of Calopteryx maculata and the similar Calopteryx aequabilis were distinguishable based on the head width and length of the proximal antennal segment. In C. maculata, the length of antennal segment 1 is approximately 0.85x than the width of the head across eyes; while the tubercles behind the eyes are prominent and acute, raised above the level of eyes; and the hind femur of the final instar larva is 7.5 mm or less. In C. aequabilis, the length of antennal segment 1 is approximately 0.95x or greater than the width of the head across eyes; while the tubercles behind eyes are low and rounded, not raised above level of eyes; and the hind femur of the final instar larva is 8.2 mm or more (Martin, 1939).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Larvae live in small to medium-sized, warm rivers and streams; especially along swiftly flowing riffle segments. They can typically be found in underwater tree roots and aquatic vegetation. Adults are often perched nearby in a head down position along streams and rivers (Biggs, 2000; Cannings, 2003; Conrad and Herman 1987; Nikula et al., 2003; Westfall and May, 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Found at clear streams of all sizes and rivers with moderate current. Can be common in places on rather tiny wooded streams, as long as there is some sun penetration. Also seen at rocky shores of large lakes in some areas.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

The larval life cycle is typically two or three years long (Martin, 1939). Flight period is from mid-June to early September in British Columbia (Cannings, 2002), early June to early September in Washington (Paulson, 1999), mid-May to mid-September in Oregon (Johnson and Valley, 2005), May to August in California (Biggs, 2000), mid-June to early September in Idaho (Logan, 1967), June to September in Minnesota, Michigan, and Wisconsin (DuBois, 2005), mid-June to late August in Ohio (Glotzhober and McShaffrey, 2002), mid-May to mid-August in Massachusetts (Nikula et al., 2003), and late May to late August in Nova Scotia (Conrad and Herman, 1990). Males are territorial defending oviposition sites and this is one of the few damselflies that court females. Courtship involves fluttering back and forth in front of a perched female and by males flinging their bodies onto the water's surface in courtship displays. Mating usually occurs on vegetation very close to the water after which the male returns to his territorial perch to guard the egg-laying female. Females lay eggs singly submerged below the water's surface. Either the tip of the abdomen or the entire female may be submerged. Adults are often found perched on streamsides in emergent vegetation often within a few feet of the shoreline. They may also fly low over the water in a bouncy manner (see Cannings, 2003; Conrad and Herman, 1987; DuBois, 2005; Martin, 1939).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calopteryx aequabilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACACTATATCTACTATTTGGAGCTTGAGCAGGAATAGTAGGAACAGCCCTAAGAATATTAATCCGCGTAGAACTTGGTCAGCCAGGGTCACTAATTGGAGATGACCAAATCTATAACGTAGTCGTTACAGCACACGCTTTTGTTATAATTTTTTTTATAGTAATACCAATTATAATCGGTGGATTTGGGAACTGATTAGTGCCCTTGATACTAGGGGCCCCTGATATAGCTTTCCCACGACTCAATAACATGAGATTTTGATTGCTACCCCCCGCCCTAACTCTGCTTCTAGCAAGAAGATTAGTAGAAAATG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calopteryx aequabilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: It is distributed broadly across northern and central North America from extreme southern British Columbia and north-central Alberta (noticeably absent from the Yukon) east to Newfoundland and Nova Scotia and New England, south to California, Nevada, Colorado, Nebraska, Indiana, Iowa and Virginia; and spotty in the west in southern Washington and east of the Cascade Mountains.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Paulson, D. R.

Reviewer/s
Clausnitzer, V. & Kalkman, V. (Odonata Red List Authority)

Contributor/s

Justification
C. aequabilis is common all across North America, in many protected areas and there is no indication of any population decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
C. aequabilis is an abundant and widespread species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no threats presently affecting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is present in many federal, state, local, and private reserves and appears no to require any further conservation actions at this time.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Calopteryx aequabilis

The River Jewelwing[1] (Calopteryx aequabilis) is a species of broad-winged damselfly. It is one out of the 170 species of the Odonata found from northeastern Alberta to Nova Scotia and south in most of the US.[2]

Description[edit]

The male has a metallic blue-green body and black wing tips. The female is duller brown with smoky wing tips that have white spots near the tips. The naiad is pale brown with darker markings.[2][3]

Habitat[edit]

It lives near small to moderae forest streams.[2]

References[edit]

  1. ^ Species Calopteryx aequabilis - River Jewelwing, BugGuide
  2. ^ a b c Calopteryx aequabilis, Entomology Collection, U. Alberta
  3. ^ Lam, Ed. (2004) Damselflies of the Northeast. Forest Hills, NY: Biodiversity Press, p.18.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Isolated populations in the west may be valid subspecies and merit further study (Westfall and May 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!