Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

The American pika is a small rodent-like relative to rabbits that has a round body, large, round ears, and is between six and eight inches long. Generally weighing about six ounces, the pika is diurnal, meaning it is active during the day.

Mating first occurs before the snow starts to melt. Females give birth to 2 to 4 offspring, which are weaned in 3 to 4 weeks. After about one month, the offspring leave the mother and grow to adult size after an additional two months. The females may mate again, and may have more than one litter. Pikas eat a variety of plants, including grasses, thistles, sedges, and flowers. The pika is active all year, and stockpiles dried vegetation deep down between rocks for the winter.

They live in between rocks on high elevation boulder and talus slopes, and are very sensitive to high temperatures.

The habitat range of the pika extends from British Columbia and Alberta in Canada, down through the Rocky Mountains to New Mexico. They are also found in the Sierra Nevada Range.

There is concern that some pika populations may be adversely affected by warming temperatures due to global climate change, which decreases the amount of suitable high elevation habitat. However, the pika is not listed as endangered or threatened as of February, 2010. A U.S. Fish and Wildlife report indicates that some pika populations may be able to adapt to higher temperatures.
Public Domain

 

Supplier: Nathan Wilson

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

"American Pikas scent-mark with their cheek glands, and also communicate with both long and short vocalizations. Short calls are uttered as alarms and to announce that they are departing or returning from foraging, and males perform a ""song"" during the breeding season. Males and females maintain individual, same-size territories, usually living next to an individual of the opposite sex. Pikas seem to spend much of the day sitting still, observing their surroundings. Females breed when they are a year old, and have a litter of three after a 30-day gestation period. The young are independent about a month after birth. Predators include coyotes, long-tailed weasels, martens, and ermine."

Adaptation: The shapes of the molar crowns of lagomorphs, such as this American pika, Ochotona princeps, and the Antelope Jackrabbit, Lepus alleni, are fairly simple on the surface but they are also un-rooted, and consequently, ever-growing, an adaptation for an extremely abrasive diet.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Richardson, J., 1828.  Short characters of a few quadrupeds procured on Capt. Franklin?s late expedition, p. 520.  The Zoological Journal, 3:516-520.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The American Pika has a widespread, but discontinuous geographic distribution throughout mountainous areas of western United States and southwestern Canada (British Columbia and Alberta) (Smith and Weston 1990, Hafner and Smith 2010). The accompanying range map demarcates the five recognized subspecies (Hafner and Smith 2010).

There is paleontological evidence that supports a past distribution that once included now-uninhabited, low-lying regions of the Great Basin and other parts of North America (Mead 1987, Hafner 1993, Grayson 2005). Following Brown's (1971, 1978) suggested mechanism of Holocene extinctions after a period of colonization during the Pleistocene, Grayson (1987, 2005) and Mead (1987) concluded that the American Pika became extinct from low-lying regions in the Great Basin between 7,500 and 5,000 B.P. The current discontinuous distribution; however, is not supported by a colonization-driven system (Brown 1971, 1978; Beever et al. 2003; Smith 1974a). Elevational distribution varies with latitude. Pikas may live from close to sea level (for example, the Columbia River Gorge, Oregon; Simpson 2009) to 3,000 m in the northern extent of their range (Smith and Weston 1990). In the southern-most portions of their range they only occasionally extend below 2,500 m and are known to occupy sites as high as 3,887 m in the White Mountains, California, and 3,786 in the Sierra Nevada, California (Smith and Weston 1990, Millar and Westfall 2010). Pikas have been reported to occur as high as 4,146 m on Wheeler Peak, New Mexico (Howell 1924) and 4,175 m on Mt. Evans and Pike’s Peak, Colorado (Markham and Whicker 1973, Erb pers. comm.). There are numerous locations where pikas persist in what would appear to be climatically marginal sites, such as: Lava Beds National Monument, California; Craters of the Moon National Monument, Idaho; the Columbia River Gorge, Oregon (where they are found as low as 30 m in elevation); the western Cascade Range, Oregon; and select localities throughout the Great Basin (Howell 1924, Horsfall 1925, Anthony 1928, Beever 2002, Beever et al. 2008, Simpson 2009, Millar and Westfall 2010, Rodhouse et al. 2010, Manning and Hagar 2011). Persistence of American Pikas in these localities appears to reflect a strong decoupling of microclimates used by pikas (which are notably temperature sensitive; see Habitats and Ecology, below) from the macroclimate of the region.

In contrast to recent findings of pikas at atypical low-elevation areas, other studies have documented extirpations of pikas on a number of historically occupied low-elevation sites throughout the Great Basin. Surveys conducted from 1994-1999 in the Great Basin found that six of 25 historical American Pika localities (records of occurrence documented from 1898–1956) appeared to be extirpated (Beever et al. 2003). Follow-up surveys conducted from 2003-2008 documented three additional extirpations and one site that appeared functionally extirpated (Beever et al. 2010, 2011). This rapid and accelerating rate of extirpation has been accompanied by an upslope movement of the low-elevation range boundary of pikas on extant sites in the Great Basin, and taken together these shifts appear to be driven by contemporary climate change (Beever et al. 2010, 2011; Wilkening et al. 2011). Recent surveys of historical sites in regions other than the Great Basin have also noted some extirpations, albeit at a smaller proportion of sites. For example, Erb et al. (in press) sampled 69 historical sites in the southern Rocky Mountains from New Mexico to Wyoming, including the lowest elevation sites within regions, and documented four extirpations (and two of these sites were subsequently recolonized (Erb pers. comm.). The Grinnell resurvey in Yosemite National Park, California, found a single extirpation of a pika population along a transect from the eastern to the western extent of the Sierra Nevada (Moritz et al. 2008). Numerous inventories and surveys are currently underway to document the extent of the species’ distribution across the geographic range of the American Pika and the status and trend of pika populations with regard to factors associated with contemporary climate change.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Geographic Range

American pikas can be found throughout the mountainous regions of western North America. Their geographic range extends as far south as New Mexico and California, as far north as British Columbia, and as far east as Colorado.

Biogeographic Regions: nearctic (Native )

  • Fitzgerald, J., C. Meaney, D. Armstrong. 1994. Mammals of Colorado. Niwot, Colorado: University Press of Colorado.
  • Beever, E., A. Smith. 2008. "Ocotona princeps" (On-line). 2008 IUCN Red List of Threatened Species. Accessed March 18, 2009 at http://www.iucnredlist.org/details/41267.
  • Chapman, J., J. Flux. 1991. Rabbits, Hares and Pikas: Status Survey and Conservation Action Plan. United Kingdom: World Conservation Union.
  • Mains, J., W. Pigott. 2008. "Life of a Pika" (On-line). Tree of Life web project. Accessed March 10, 2009 at http://www.tolweb.org/treehouses/?treehouse_id=4868.
  • Smith, A., M. Weston. 1990. "Mammalian Species No.352 - Ochotona princeps" (On-line pdf). Accessed March 10, 2009 at http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/pdf/i0076-3519-352-01-0001.pdf.
  • Wolf, S., B. Nowicki, K. Siegel. 2007. "Petition to List the American Pika (Ochotona Princeps) as Threatened Under the California Endangered Species Act" (On-line pdf). Accessed March 28, 2009 at http://www.biologicaldiversity.org/species/mammals/American_pika/pdfs/petition_ca-2007.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Distributed discontinuously in mountainous areas in western North America, from central British Columbia and southern Alberta south to east-central California, Nevada, southern Utah, and northern New Mexico; east to Wyoming and Colorado; ranges from sea level to 3000 m in north, uncommon below 2500 m at southern range limit (Smith and Weston 1990; Hoffmann, in Wilson and Reeder 1993). See detailed map in Hafner and Sullivan (1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Ochotona princeps is intermediate in size when compared to other ochotonids. Its body mass exhibits a great deal of variation and ranges from 121 to 176 grams. In certain parts of its range, males are larger than females, but only slightly (Smith and Weston, 1990). The body of O. princeps is ovoid, with short ears, long vibrissae (40-77 mm), short limbs, and no visible tail. Its hind paws are digitigrade, have four toes (compared to five on the front), and range from 25 to 35 mm in length. Both sexes have a pseudocloacal openings, which must be everted to expose the penis or clitoris. Females have six mammae which do not enlarge during lactation. Ochotona princeps has a high body temperature (average of 40.1°C) and relatively low upper lethal temperature (average of 43.1°C). It has a high metabolic rate (1.53 cm^3 oxygen/hour), and thermoregulation is behavioral rather than physiological.

Pelage color of American pikas changes seasonally but maintains an off-white hue on its ventral surface (as opposed to white in Ochotona collaris). On its dorsal surface, pelage ranges from grayish to cinnamon-brown in the summer. In the winter, their dorsal pelage is gray and is twice as long as summer pelage. Their ears are round, covered with dark hair on their internal and external surfaces, and edged in white. Their paws are densely furred, including the soles, with the exception of small black naked pads at the ends of the toes (Smith and Weston 1990). Their skull is slightly round with a flat, broad interorbital region. Other distinguishing characteristics of the American pika's skull include a slender rostrum, nasals that are widest anteriorly, maxillae with one large fenestration (rather than numerous small fenestrae of Leporidae), an elongated jugal, which forms a prominent projection from the posterior zygomatic arch, and a dental formula of 2/1, 0/0, 3/2, 2/3 totaling 26 teeth.

Range mass: 121 to 176 g.

Range length: 162 to 216 mm.

Average basal metabolic rate: 1.53 cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

Average basal metabolic rate: 0.932 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 22 cm

Weight: 128 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Range: 162-216 mm

Weight:
Range: 121-176 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

The American Pika is a candidate indicator species for the effects of climate change (in particular, global warming, although interactions with precipitation and snowpack merit continuing attention), because it occurs in a very specific insular habitat type, has a very low reproductive rate (counterbalanced by being relatively long-lived for a small mammal), exhibits very limited dispersal ability, and is primarily diurnal and extremely sensitive to warm temperatures.

The American Pika is a typical rock-dwelling species of pika (Smith et al. 1990). It primarily inhabits talus and talus-like formations adjoining a meadow or source of vegetation in cool and moist microclimates across western North America (Smith and Weston 1990, Hafner 1994, Millar and Westfall 2010). Talus habitat is typically insular or patchy in nature at several spatial resolutions (Smith 1974a, Smith and Gilpin 1997). Pikas prefer talus in RIF (rock-ice-feature) formations (83% of sites in one study of 420 pika sites), and with rock diameters of 0.2-1.0 m (Tyser 1980, Hafner 1994, Beever et al. 2010, Millar and Westfall 2010). They may also occur in lava flows and anthropogenic habitats such as mine ore dumps or road cuts; occasionally they may live in piles of logs or similar habitat (Smith 1974a,b; Millar and Westfall 2010; Rodhouse et al. 2010; Manning and Hagar 2011).

American Pikas are individually territorial on talus habitat (as calculated above; at a density approximating 20 individuals per hectare). Pikas are relatively long-lived for a small mammal (120–175 g); some pikas may live to the age of 6 or 7 years, and many live to the age of 3-4 years (Millar and Zwickel 1972a; Smith 1978). The reproductive rate of American Pikas is low; females initiate two litters per year, although it is most common for only one litter to be weaned successfully (Smith 1978; Smith and Ivins 1983a; Smith and Weston 1990). Average litter size at time of parturition ranges from 2.3–3.7 (range 1–5 young), although there is an erosion of fecundity during weaning such that most females only successfully wean two (or at the most three) young per year (Smith 1978; Smith and Weston 1990). Mortality rate is highest in the juvenile age class (Millar and Zwickel 1972a; Smith 1978). Juveniles must claim a vacant territory to survive the winter, and in saturated populations availability of vacant territories is contingent on the low mortality rate of adults (Smith 1978; Smith and Ivins 1983b).

In ecological studies where pikas have been individually marked, American Pikas have consistently been found to be poor dispersers (Tapper 1973, Smith and Ivins 1983b, Smith 1987, Peacock 1997). It is rare for an adult to disperse; once settled on a territory, they tend to remain there for life (the occasional dispersal movement by an adult is to move to a vacant site adjoining its home territory if it is of substantially higher quality; Smith and Ivins 1983b; Smith 1987). Juveniles tend to remain philopatric, largely occupying space in the interstices between adult territories. Juveniles also time-share activity periods with resident adults; they are primarily active when adults are inactive. This strategy ensures that juveniles are familiar with a region of talus so that they can claim any territory vacancy that may appear (Smith and Ivins 1983, 1987; Tapper 1973; Smith 1987). As a result, few juveniles attempt to disperse away from their birthplace. When juveniles attempt to disperse within a talus patch, they are socially rebuked by non-parental adults; when they leave a patch in an attempt to find available talus elsewhere, they increase their exposure to predators and are unable to use the safety of the talus to cool themselves if the ambient conditions are too warm (Smith 1974b, Smith and Ivins 1983, Smith 1987). Ability of juveniles to engage in long-distance (intra-patch) dispersal appears related to temperature. At low elevations dispersal distance and probability of success are low (Smith 1974 a,b; Peacock and Smith 1997; Smith and Gilpin 1997). Most observed long-distance dispersal has occurred at higher elevations where the talus tends to be more continuous and it is cooler (Tapper 1973; Smith 1974 a,b; Smith 1987; Peacock 1997). An understanding of pika dispersal is necessary because most observed pika population extirpations have occurred at low (hot) elevations, and it is under these conditions that probability of subsequent re-colonization of these sites is extremely low. When a high-elevation population temporarily disappears, its chance of being recolonized is significantly greater (Tapper 1973, Smith 1987).

Pikas are very sensitive to warm or hot temperatures; when daytime temperatures are hot during summer, they tend to avoid the warmer temperatures and concentrate their activity at dawn and dusk (MacArthur and Wang 1974, Smith 1974b). Under these conditions, they may even exhibit nocturnal behaviour (Smith 1974b). Pikas have a relatively high body temperature and a relatively low upper lethal temperature; thus, they have very little flexibility with regard to physiological temperature regulation. Field experiments have shown that when confined in the sun and unable to behaviourally thermoregulate (such as by darting into the interstices of the talus where it is always significantly cooler), they can die at relatively low ambient temperatures (25.5 – 29.4oC)(MacArthur and Wang 1973, 1974; Smith 1974b). This temperature sensitivity puts dispersing pikas, particularly at lower, warmer elevations, at increased risk and is why restricted dispersal distances under these conditions are most commonly observed (Smith 1974a,b). Relative vulnerability of pika populations to climatic stress may be indexed by variables such as latitude and elevation, two factors known to affect local climate and, in turn, the distribution of American Pikas (Grinnell 1917, Smith 1974a, Beever et al. 2011).

Pikas are generalized herbivores. As the American Pika does not hibernate, it must collect food during summer that it stores in a haypile or cache in the talus to serve as food during winter. Thus, during the summer the pika has two distinctly different foraging strategies: the direct consumption of food and haying behaviour (Huntly et al. 1986). Haying reaches a crescendo in mid-late summer; during this time a pika may make hundreds of trips each day off the talus to clip and harvest plants for its haypile (Smith and Ivins 1984). The plants available to a pika to eat or hay are restricted to the vegetation on or adjoining its territory. Pikas are highly selective of which plants they consume or harvest, choosing plants that are higher in water content, protein, and select micronutrients (West 1981, Millar and Zwickel 1972b) and other characteristics (reviewed in Smith and Weston 1990). The timing of haying is related to the phenology of plants at any given altitude (that is, they begin and end this activity earlier at lower elevations), gender (males generally initiate haying earlier) and age (adults begin haying before juveniles) (Smith 1974b, Smith and Weston 1990).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

American pikas inhabit areas of broken rock and talus fields fringed by alpine meadows. They are most common in cool, moist habitats above tree line. In the northern part of their range, they can be found from sea level to 3,000 meters; however, in the southern part of their range, American pikas are rarely found below 2,500 meters (Chapman and Flux, 1991).

Range elevation: sea level to 3000 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; taiga ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Restricted to rocky talus slopes, primarily the talus-meadow interface. Often above treeline up to limit of vegetation. Also found at lower elevations in rocky areas within forests or near lakes. Occasionally on mine tailings, or piles of lumber or scrap metal. Does not dig burrows but may enlarge den or nest site under rock.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

American pikas are generalized herbivores that select forage by assessing its nutritional value. Preferred plants have higher protein, lipid, and water content and higher caloric value than non-preferred plants (Chapman and Flux, 1991). Although certain plant species are avoided due to the presence of toxins, these plants may be cached in haypiles for winter consumption. Some toxins act as natural preservatives that wear off by the time the plant is consumed. Caching, also known as haying, occurs during summer. Haypiles generally consist of forbs and tall grasses, but up to 30 species of plants may be found in a single haypile. Most haypiles are constructed near the talus-meadow interface and serve as territory markers. When winter arrives, haypiles are moved into burrows and used as their main food supply. During winter, American pikas may also feed upon cushion plants and lichens in the subnivean zone to supplement their diet. In the summer, American pikas typically eat short alpine grasses. Forbs and shrubs constitute 78 to 87% of their diet, with alpine avens, clovers, and sedges making up the remaining 22 to 13% of their diet (Fitzgerald, Meaney, and Armstrong, 1994). Occasionally, conifer needles and bark are also eaten. They are not obligate drinkers as water is primarily obtained via ingested plants.

American pikas create two types of fecal droppings: a hard brown round pellet and a soft shiny string of material (the caecal pellet). Pikas consume the caecal pellet (which has high energy value and protein content) or store it for later consumption. Only about 68% of the ingested food is assimilated, making the caecal pellets an important part of the American pika's diet.

Plant Foods: leaves; wood, bark, or stems; flowers

Other Foods: dung

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Folivore , Lignivore); coprophage

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds primarily on grasses and sedges; also eats some flowering plants and shoots of woody vegetation. In late summer and fall, harvests and stores food (forbs, grasses, marmot pellets) for winter consumption; stored food may be most important when winter is unusually harsh or long (see Smith and Weston 1990). May forage in winter in snow tunnels. Ingests caecal pellets, either directly or after storage.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

American pikas are considered allogenic engineers (i.e., altering the environment through their activities). Their large haypiles, containing both plant and fecal matter, are not entirely consumed during the winter, leaving large accumulations of decomposing biomass to act as fertilizer and a potential food source for other animals. As fertilizer, haypiles ultimately increase soil nitrogen, a limiting resource for vegetation at high altitude.  Also, American pikas are host to many species of intestinal parasites (Coccidia) and parasitic fleas (Siphonaptera).

Ecosystem Impact: keystone species

Commensal/Parasitic Species:

  • Eimeria cryptobarretti
  • Eimeria banffensis
  • Eimeria calentinei
  • Eimeria klondikensis
  • Isospora marquardti
  • Eimeria barretti
  • Eimeria princeps
  • Eimeria worleyi
  • fleas (Siphonaptera)

  • Aho, K., N. Huntly, J. Moen, T. Oksanen. 1998. Pikas (Ochotona princeps: Lagomorpha) as Allogenic Engineers in an Alpine Ecosystem. Oecologia, 114/3: 405-409. Accessed April 07, 2009 at http://www.jstor.org.proxy.lib.umich.edu/stable/4221946?seq=1.
  • Bossard, R. 2006. Mammal and Flea Relationships in the Great Basin Desert: From H.J. Egoscue's Collections. Journal of Parasitology, 92/2: 260-266. Accessed April 07, 2009 at http://www.bioone.org.proxy.lib.umich.edu/doi/full/10.1645/GE-3545.1.
  • Lynch, A., D. Duszynski, J. Cook. 2007. Species of Coccidia (Apicomplexa: Eimeriidae) Infecting Pikas From Alaska, U.S.A and Northeastern Siberia, Russia. Journal of Parasitology, 93/5: 1230-1234. Accessed April 07, 2009 at http://www.bioone.org.proxy.lib.umich.edu/doi/full/10.1645/GE-1206R.1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

American pikas are moderately camouflaged and when a potential predator is detected, they emit an alarm-call informing the rest of the community of its presence. Alarm calls are emitted less frequently for small predators, as small predators may be able to chase them into the talus interstices. Small predators consist of long-tailed weasels (Mustela frenata) and ermines (Mustela erminea). Large predators, such as coyotes (Canis latrans) and American martens (Martes americana), are especially adept at capturing juveniles who are not quick enough to escape. Golden eagles (Aquila chrysaetos) also feed on American pikas, but their impact is minimal.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Home range size varies seasonally, largest during spring breeding season; defends haypiles in late summer. May defend territory; home range size about twice as large. Male and female territories average same size. Reported home ranges: 0.3-0.5 ha (Barash 1973); and mean 0.26 ha, range 0.04-0.30 ha (Kawamichi 1976). Adjacent home ranges tend to be occupied by opposite sexes. Population density was 3-10 per ha in favorable habitat in Colorado in mid-August (same as in other regions); population relatively stable due to density-related social behavior (Southwick et al. 1986). Juveniles tend to stay on natal home range or an adjacent one. Adult mortality 37-56% per year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

American pikas communicate via vocalizations and scent marking, and they can discriminate between individuals through calls and cheek-gland secretions. They make 2 characteristic vocalizations, short calls and long calls. Short calls are used as an alarm when predators are present or as a warning signal to potential intruders (i.e., to defend one's territory). Alarm calls are usually repetitive short calls that change in frequency depending on the type of predator seen (e.g., large vs. small). Long calls are almost exclusively given by adult males and are most common during breeding season, owever, both males and females may sing in the autumn. Short call duets are also sung by mating pairs in an effort to maintain social tolerance.

American pikas use urine, feces, and cheek marks while scent marking. Cheek markings, produced from apocrine sweat glands, are used to attract potential mates and to demarcate territories. They are spread by both sexes by rubbing their jowls on rocks. During breeding season or upon colonization of a new territory, cheek marking occurs with elevated frequency. Urine and feces are usually placed by haypiles to mark ownership.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: duets ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active throughout the year. Relatively inactive on warm days; near lower elevational limit may be inactive at midday in hot weather (Smith and Weston 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average annual mortality of American pikas is 37 to 53%, and age-specific mortality is highest for 0 to 1-year-olds and 5 to 7-year-olds. The maximum age of American pikas in the wild and in captivity is 7 years, with an average life expectancy of 3 years in the wild.

Range lifespan

Status: wild:
7 (high) years.

Range lifespan

Status: captivity:
7 (high) years.

Average lifespan

Status: wild:
3 years.

Average lifespan

Status: wild:
6.0 years.

Average lifespan

Status: wild:
7.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7 years (captivity) Observations: It has been estimated that these animals live up to 7 years in the wild (David Macdonald 1985). One wild born captive specimen was about 7 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

American pikas are monogamous, and mate pairs are formed with adults from adjacent territories. When more than one potential mate is available, females may exhibit mate choice (Smith and Weston, 1990).

Mating System: monogamous

American pikas typically mate as yearlings. Males are considered sexually active when their testes are 11 mm in length or greater (Smith and Weston, 1990). American pikas are reflex ovulators (i.e., ovulation only occurs after breeding) and are seasonally polyestrus. Each female has 2 litters per year, with an average of 3 young per litter. Breeding commences 1 month before snow-melt and gestation last approximately 30 days. At low elevations, parturition occurs as early as March but occurs from April to June at higher elevations. Pups weigh between 10 and 12 g at birth and are weaned by 28 days old. Lactation significantly reduces a female's fat reserves, and although females exhibit postpartum estrus, they only nurse the second litter if the first does not survive.

Breeding interval: American pikas breed twice yearly, during the same breeding season.

Breeding season: American pikas breed one month before snow-melt and once again following the birth of their first litter (postpartum estrus)

Range number of offspring: 1 to 6.

Average number of offspring: 3.

Average gestation period: 30 days.

Range birth mass: 10 to 12 g.

Range weaning age: 18 to 35 days.

Average weaning age: 28 days.

Average time to independence: 4 weeks.

Average age at sexual or reproductive maturity (female): 347 days.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; fertilization ; viviparous ; post-partum estrous

Average gestation period: 30 days.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (female)

Sex: female:
347 days.

American pikas are born slightly altrical; they are blind, slightly haired, have fully erupted teeth, and weigh between 10 and 12 grams at birth. For the first 18 days, young are completely dependent on their mothers. Pups open their eyes at 9 days of age. Mothers spend most of their time foraging, but visit the nest once every 2 hours to nurse for an average of 10 minutes. Pups become independent by about 4 weeks old (soon after weening). American pikas exhibit a remarkable growth rates compared to other members of Lagomorpha, and can reach adult size after only 3 months (Smith and Weston, 1990).

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Smith, A., M. Weston. 1990. "Mammalian Species No.352 - Ochotona princeps" (On-line pdf). Accessed March 10, 2009 at http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/pdf/i0076-3519-352-01-0001.pdf.
  • Wolf, S., B. Nowicki, K. Siegel. 2007. "Petition to List the American Pika (Ochotona Princeps) as Threatened Under the California Endangered Species Act" (On-line pdf). Accessed March 28, 2009 at http://www.biologicaldiversity.org/species/mammals/American_pika/pdfs/petition_ca-2007.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seasonally polyestrus. Gestation lasts approximately 30 days. Produces 1 or 2 litters of usually 2-5 young/litter (average often 3 at high elevations), between May and September; most young come from first litters. In most areas parturition begins in May with a peak in June, occurs as early as March in some low elevation areas (Smith and Weston 1990). In Colorado, initiates 2 litters annually but only one is weaned; births late June-early August. Young dependent on mother for at least 18 days, weaned as early as 3-4 weeks. Juveniles establish territories and haypiles in summer of birth, but do not breed until their 2nd summer. Maximum lifespan 7 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ochotona princeps

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0118-06|AJ537415|Ochotona princeps| AACCGTTGATTGTTCTCCACAAATCACAAAGACATCGGCACCCTATACATACTATTCGGCGCTTGGGCTGGAATAGTGGGTACCGCACTC---AGCCTTCTCATCCGAGCCGAACTTGGACAACCAGGAGCCCTACTAGGAGAT---GACCAAATTTACAACGTAATCGTCACAGCCCACGCTTTTGTCATAATTTTCTTCATAGTAATACCAATTATAATCGGAGGTTTCGGTAATTGATTAGTACCACTAATA---ATTGGTGCGCCCGATATAGCTTTCCCCCGAATAAATAATATAAGCTTCTGACTTCTACCACCCTCCTTTCTACTCCTATTAGCATCCTCAATAGTCGAAGCAGGGGTAGGAACCGGTTGAACAGTCTACCCCCCTCTAGCCGGCAACTTAGCCCACGCAGGAGCATCCGTAGATCTA---GCAATCTTCTCCCTTCATCTAGCCGGTATCTCCTCAATTCTTGGCGCTATCAATTTCATCACAACAATTATTAATATAAAACCCCCAGCCATATCCCAATACCAAACCCCCTTATTTGTCTGATCTGTCCTAATTACAGCGGTCCTACTGCTACTCTCTCTACCAGTCCTAGCAGCA---GGAATCACAATGCTTTTAACAGACCGAAACCTAAACACAACTTTCTTCGACCCAGCAGGAGGCGGAGACCCTATTCTGTATCAGCACTTATTCTGATTCTTTGGCCACCCCGAAGTTTACATTTTAATTCTACCGGGATTCGGTGTAATCTCCCATATCGTCACTTACTACTCCGGCAAAAAA---GAACCTTTCGGCTACATAGGAATAGTTTGAGCCATAATATCCATTGGTTTCCTAGGGTTTATTGTCTGAGCCCACCATATATTTACAGTAGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ochotona princeps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Beever, E. & Smith, A.T.

Reviewer/s
Hik, D. & Johnston, C.

Contributor/s

Justification
Pikas are listed as Least Concern. The USFWS has issued a finding that the species is not Endangered under the U.S. Endangered Species Act. Similarly, the California Fish and Game Commission has ruled twice that the pika not be considered Endangered under the state’s Endangered Species Act. The only declines that have been adequately quantified (in the Great Basin): 1) do not include all the available pika habitat in the Great Basin (pikas exist in other mountain ranges and at higher elevations than the targeted sites that were censused); 2) represent only a small fraction of all pika populations within the range of the species; and 3) still do not document (even within the region) the necessary 80–90% decline needed for an A criterion judgement. The extent of occurrence (EOO) (918,919 km²) and area of occupancy (AOO) (918 km²; considering an estimate that 0.1% EOO = AOO) for American Pikas are far higher than any of the B criteria thresholds. The population of mature individuals was very roughly estimated at 1,837,839, which is significantly greater than the thresholds for criteria C and D.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Due to its abundance and widespread distribution, the IUCN lists Ochotona princeps as a species of least concern. However, of the thirty six recognized subspecies, seven are listed as vulnerable and one, O. p. schisticeps, is listed as near threatened. The seven vulnerable subspecies (O. p. goldmani, O. p. lasalensis, O. p. nevadensis, O. p. nigrescens, O. p. obscura, O. p. sheltoni, and O. p. tutelata) are all found in the Great Basin and are currently experiencing major threats that have resulted in local extirpations. The greatest threat to American pikas, especially those in the Great Basin, is likely global climate change as they are extremely sensitive to high temperatures. American pikas can die within an hour if ambient temperatures rise above 23°C (75°F). Many populations are expected to migrate north or move to higher elevations. Unfortunately, American pikas are very poor dispersers.

Various organizations have suggested placing Ochotona princeps under the protection of the endangered species act. Potential solutions to local population declines may include legislation changes to decrease the amount of global warming stressors, increasing awareness, identification of new protected areas, and re-introductions in areas where O. princeps has been extirpated.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • Blakemore, B. 2007. "
    Route to Extinction Goes up Mountains, Scientists Say. Global Warming Is Forcing the American Pika up Mountains and Toward Extinction.
    " (On-line). Accessed April 01, 2009 at http://abcnews.go.com/WN/story?id=3155909&page=1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Seven subspecies are Vulnerable: O. princeps goldmani, O. princeps lasalensis, O. princeps nevadensis, O. princeps nigrescens, O. princeps obscura, O. princeps sheltoni, and O. princeps tutelata
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

American Pikas are individually territorial (male and female territories are of approximately similar sizes; Smith and Ivins 1984) on a very discrete and identifiable habitat type, talus or piles of broken rock. Although territory size may vary seasonally and by habitat quality, a rough average from several detailed studies (reviewed in Smith and Weston 1990) is approximately 500 m². This size also roughly corresponds to the area as determined by the average nearest-neighbour distance (diameter of a pika territory; area determined by πr²) between centers of activity of individuals (basically, the average distance between haypiles; Smith and Weston 1990). Thus in prime talus habitat, about 20 pikas may occur per hectare. The extent of occurrence (EOO) is 918,920 km² (the sum of the minimum convex polygons of each of the five subspecies), and this naturally includes a significant amount of habitat that is unsuitable for pikas (intervening low-elevation valleys, forests, wetlands, cliff faces). Assuming that the area of occupancy (AOO; suitable talus habitat occupied by pikas) is a very conservative 0.1% of the EOO, the global population of the American Pika is approximately 1,837,839. This rough calculation of abundance of mature individual American Pikas globally far exceeds the cut-off for a threatened category listing using Criteria C (<10,000 mature individuals). We caution that our estimate of AOO at 0.1% of EOO needs to be verified; the proportion of area within the species’ range that is comprised of talus is unknown, and to determine this area will take a detailed remote-sensing analysis. In addition, the extent of available talus that contains suitable pika habitat is unknown (for example, talus comprised of pika-relevant rock diameters and occurring within the thermal belt that can be occupied by pikas). Finally, it is necessary to know the proportion of suitable pika habitat that is occupied over the global range of the species, and extensive censuses conducted throughout the range of pikas are needed to determine this value.

As highlighted in the discussion of Distribution (above), pika populations are declining in some parts of the species’ geographic range, primarily at low elevations in the Great Basin (populations being lost, and other populations shifting their distribution upslope). From everything we know about pika biology (thermally sensitive) and dispersal ability (extremely limited, especially in warm environments; MacArthur and Wang 1973, 1974; Smith 1974a,b), it is unlikely that any of these lost populations can be resettled within ecological time – thus they represent a loss and we conclude that the global population is decreasing.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats

The most pervasive threat affecting the American Pika appears to be contemporary climate change. While the species as a whole is Least Concern, large tracts of the EOO—namely across the Great Basin – have seen local population extirpations, range contractions (upslope movement of the lower-elevation range boundary), and reduced densities (Beever et al. 2003, 2010, 2011; Wilkening et al. 2011). Three alternative classes of direct thermal stresses may affect the persistence of pika populations (Beever et al. 2010): 1) acute cold stress (number of days below a very cold threshold temperature); 2) acute heat stress (number of days above a warm threshold temperature; and 3) chronic heat stress (such as average summer temperature). Acute cold stress may arise from reduced snowpack (observed across western North America; Mote et al. 2005) which in turn may result from more precipitation falling as rain and less as snow, or warmer days leading to a more rapid melt-off of snowpack, or both. Without the snowpack that acts as an insulator during winter, pikas might freeze or extinguish their food supplies while attempting to thermoregulate leading to an increase in mortality (Smith 1978, Beever et al. 2010). While some areas have extant populations at higher elevations to and from which pikas could disperse, the insular nature of talus habitat means that many populations that become extirpated will remain so on an ecological time scale – the likelihood of recolonization is extremely remote. While extinctions in the Great Basin have been going on for a long time (~7,500 years), the recent rate is high and indicative of observed increases in temperature in the region due to climate change (Beever et al. 2011). Current American Pika distributions in the Great Basin represent a perfect storm generated by the high temperatures (in summer) and reduced snowpack (in winter; Mote et al. 2005) caused by climate change.

A counterbalance to the data accumulated in the Great Basin is the population of pikas at Bodie, California, at about 2,550 m elevation just 35 km west of the Sierra Nevada crest where summer temperatures are relatively warm. There pikas occupy insular patches of habitat (ore dumps left by mining activity) that are spaced across a landscape of Great Basin shrub vegetation. This classic metapopulation, the longest-term study of any pika species, has been observed since the late 1940s (Severaid 1955) and semi-continuously since 1969 (Smith 1974 a, b, 1978, 1980; Smith and Gilpin 1997), including annual censuses (with a couple of two-year gaps) from 1989 to 2010 (Smith unpublished data). Approximately 78 ore dump patches have been included in each census. In 1991 the southern half of the figure-eight-shaped study area experienced a meta-population collapse and has not recovered (Smith and Gilpin 1987); in 2010 the southern constellation of patches was still void of pikas. However, the 37 patches in the northern constellation showed a slightly higher occupancy rate in 2009 (84%; the lowest percent occupancy was 49% in the north) than in the first full census in 1972. Thus, there appears to be no evidence that heat stress in summer at Bodie causes mortality or population decline of pikas on these small habitat islands, although warm temperatures may have inhibited colonization of the southern constellation.

Another largely Great Basin threat is competition with free-ranging and feral cattle in those situations where livestock are allowed to graze within the typical pika foraging distance from the talus margin (Beever et al. 2003). Most pikas live in cattle-free areas or, in Colorado, grazing temporally occurs primarily in fall after pikas have completed their haypiles. But in the Great Basin cattle graze adjoining many of the limited pika populations. Beever et al. (2003) noted that cattle grazing could be contributory to some pika population extirpations. Pika density was lower in areas that were heavily grazed – primarily small sites with more edge compounding the effect of grazing (Beever unpublished data). Further, presence of livestock grazing increased in importance from the 20th century observations to the 1999–2008 observation period in terms of predicting the pattern of site-level persistence of pikas in the Great Basin (Beever et al. 2011). Millar (in press) has compared placement of pika haypiles in Great Basin ranges at sites with and without cattle grazing. Normally, pikas place their haypiles close to the talus/vegetation interface; at her cattle-free sites this distance averaged 1.8 m from the talus edge. At grazed sites pikas placed their haypiles an average of 30 m upslope from the talus edge and were forced to forage on comparatively poor vegetation growing amidst the rocks. Millar concluded that grazing effects could be contributing to observed regional differences in viability of pikas
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
  • Pikas occur in many national parks and other protected areas throughout their range in the United States and Canada. Pikas tend to occupy areas away from human habitations or influence, and they appear to not be negatively influenced by trails or nearby roads that do encroach on their habitat (for example, they often colonize road cuts (Manning and Hagar 2011, Millar and Smith pers. obs.). Neither hunting nor trapping of American Pikas is allowed throughout their range.
  • Additional research on the potential competitive relationship between livestock grazing and pikas in the Great Basin should be initiated, and if it is shown that competition between pikas and livestock occurs and increases the probability of local extirpation of Great Basin pika populations, management plans should be enacted to eliminate grazing in areas adjoining known pika populations.
  • The American Pika should be considered an early-warning indicator species for the effects of climate change and continuously monitored throughout their range to demonstrate how a species with these attributes could adapt and be resilient in the face of climate change, or to determine their decline and how it could be reversed. Particular attention should be given to the establishment of scientifically valid protocols for 1) long-term monitoring of populations; 2) parsing out the relative contributions of acute cold stress, acute heat stress and chronic heat stress on pikas given climate change throughout the range of the species; 3) monitoring of pika behaviour with relation to micro-climates present in their environment; 4) determining how food selectivity indices may vary across the range of the species and how these may be affected by climate change; 5) determining any measurable manifestations of physiological stresses on pikas, such as disease, increased levels of stress hormones, reduced reproductive capacity, reduced longevity, etc., as a result of climate change; 6) understanding the relationships of American Pikas with other syntopic and sympatric species such as marmots (Marmota spp.), woodrats (Neotoma spp.), chipmunks (Tamias spp.), etc.; and 7) understanding the additive or synergistic roles that multiple types of climate stress can have in concert (such as lower growing season precipitation combined with warmer summer average temperatures).
  • Particular attention should be given to examine and inventory sites of accurate historical low-elevation records of occurrence of pikas, as contemporary observations at these sites can give us a quantitative measure of potential change over time in the distribution and abundance of American Pikas with regard to climate change.
  • If it is shown that climate change is negatively influencing the American Pika range-wide and potentially endangering the species, accommodation, mitigation and active conservation strategies should be enacted at the regional, national and international scales.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Ochotona princeps on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive effects of Ochotona princeps on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American Pika

The American pika (Ochotona princeps), a diurnal species of pika, is found in the mountains of western North America, usually in boulder fields at or above the tree line. They are herbivorous, smaller relatives of rabbits and hares.[3]

Contents

Description

The American pika, known in the 19th century as the "little chief hare",[4] has a small, round, ovate body. Their body length ranges from 162 to 216 millimeters (6-8 inches). Their hind feet range from 25 to 35 mm (1-1½ in).[5] They usually weigh about 170 grams (6 ounces).[6] Body size can vary among populations. In populations with sexual dimorphism, males are slightly larger than females.[7]

The American pika is intermediate in size among pikas. The hind legs of the pika do not seem to be much longer than its front legs and its hind feet are relatively short when compared to most other lagomorphs.[7] It has densely furred soles on its feet except for black pads at the ends of the toes.[7] The ears are moderately large and sub-orbicular and are hairy on both surfaces, normally dark with white margins. The pika has a tail that is "buried" and is longer relative to body size compared to other lagomorphs.[7] Its has a slightly rounded skull with a broad and flat pre-orbital region. The fur color of the pika is the same for both sexes but varies by subspecies and season.[7] The dorsal fur of the pika ranges from grayish to cinnamon-brown, often colored with tawny or orchraceous hues, during the summer. During winter, the fur becomes grayer and longer.[7] The dense under-fur is usually slate-gray or lead colored. It also has whitish ventral fur.

This individual was at 603 metres (1,978 ft) in Mount Baker-Snoqualmie National Forest.

Distribution and habitat

The American pika can be found throughout the mountains of western North America, from central British Columbia in Canada to the US states of Oregon, Washington, Idaho, Montana, Wyoming, Colorado, Utah, Nevada, California and New Mexico.[6]

Pikas inhabit talus fields that are fringed by suitable vegetation on alpine areas. They will also live in piles of broken rock.[7][8] Sometimes, they will live in man-made substrate such as mine tailings and piles of scrap lumber. Pikas usually have their den and nest sites below rock around 0.2-1 m in diameter but often sit on larger and more prominent rocks. They generally reside in scree near or above the tree line. Pikas are restricted to cool moist microhabitats on high peaks or watercourses.[8] Intolerant of high diurnal temperatures, in the northern portion of their range they may be found near sea level, but in the south they are rare below 2,500 metres (8,200 ft).[7] Pikas rely on existing spaces in the talus for homes and do not dig burrows. However they can enlarge their home by digging.[7]

Diet

The American pika is a generalist herbivore. It eats a large variety of green plants, including different kinds of grasses, sedges, thistles and fireweed. Pikas can meet their water demands from the vegetation they eat. However they drink water if it is available.[9] Pikas have two different ways of foraging. They will directly consume food (feeding) or they will cache food in haypiles to use for a food source in the winter (haying).[7] The pika feeds throughout the year while haying is limited to the summer months. Since they do not hibernate, pikas have greater energy demands than other montane mammals. In addition, they also make 13 trips per hours to collect vegetation when haying.[10] It seems that the timing of haying correlates to the amount of precipitation from the previous winter.[11] Pikas will start and then quit haying earlier in years following little snow and early spring. In areas at lower elevations, haying begins before the snow has melted at high altitudes while at higher elevations, haying continues after it ends in lower elevations.[11]

When haying, pikas harvest plants in a deliberate sequence, corresponding to their seasonal phenology.[7] They seem to assess the nutritional value of available food and harvest accordingly. Pikas select plants that have the higher caloric, protein, lipid and water content.[7] Forbs and tall grass tend to be hayed more than eaten directly. Haypiles tend to be stored under the talus near the talus-meadow interface although they may be constructed on the talus surface. Males generally store more vegetation than females and adults usually store more than juveniles.[7] Pikas deposit two kinds of fecal droppings: Hard brown round pellets and caecal pellets that are soft black shiny strings that form in the caecum.[7] Caecal pellets have more energy value than stored plant food and the pika may consume them directly or store them for later.[7]

Life history

The American pika's cryptic coloration helps it blend in with its environment in the Sierra Nevada.

American pikas are diurnal. The total area of land which an American pika uses is known as a home range. Approximately 55% of its home range is territory which the pika defends against intruders. Territory size can vary from 410-709 m² and is dependent on configuration, distance to vegetation and quality of vegetation.[7] The home ranges of pika may overlap with the distances of the home ranges of a mating pair being shorter than that of the nearest neighbors of the same sex.[7] Spatial distances between adults of a pair is greatest during early and mid summer and reduces during late summer and early autumn. Pikas defend their territories with aggression. Actual aggressive encounters are rare and usually occur between members of the same sex and those unfamiliar with each other. A pika may intrude on another’s territory but usually when the resident is not active. During haying, territorial behavior increases.[9]

Adult pikas of the opposite sex with territories adjacent form mated pairs. When there is more than one male available, females will exhibit mate choice.[7] Pikas are reflex ovulators, that is ovulation only occurs after copulation, and they are also seasonally polyestrous. A female has 2 litters per year and these litters average 3 young each. Breeding takes place one month before the snow melts and gestation lasts approximately 30 days. Parturition occurs as early as March in lower elevations but occurs from April to June at higher elevations. Lactation significantly reduces a female's fat reserves and they only nurse the second litter if the first does not survive, despite exhibiting postpartum estrus.[7] Pikas are born slightly altricial, being blind, slightly haired, and having fully erupted teeth. They weigh between 10 and 12 grams at birth. At around nine days, they are able to open their eyes.[7] Mothers forage most of the day and return to the nest once every two hours to nurse the young. Young become independent after 4 weeks, around the same time they are weaned.[7] Young may remain in their natal or an adjoining home range. When in their home range, young occupy areas away from their relatives as much as possible. Dispersal appears to be caused by competition for territories.[12]

Pikas are vocal, using both calls and songs to communicate among themselves. A call is used to warn when a predator is lurking nearby, and a song is used during the breeding season (males only), and during autumn (both males and females).[6] Predators of the pika include eagles, hawks, coyotes, bobcats, foxes, and weasels.

Conservation and decline

As they live in the high and cooler mountain regions, they are very sensitive to high temperatures, and are considered to be one of the best early warning systems for detecting global warming in the western United States.[13] Temperature increases are suspected to be one cause cause of American pikas moving higher in elevation[14] in an attempt to find suitable habitat, as well as cooler temperatures. American pikas, however, cannot easily migrate in response to climate change, as their habitat is currently restricted to small, disconnected habitat "islands" in numerous mountain ranges.[15] Pikas can die in six hours when exposed to temperatures above 25.5°C (77.9°F) if individuals cannot find refuge from heat. In warmer environments, such as during midday sun and at lower elevation limits, pikas typically become inactive and withdraw into cooler talus openings.[11] Because of behavioral adaptation, American pikas also persist in the hot climates of Craters of the Moon and Lava Beds National Monuments (Idaho and California, respectively). Average and extreme maximum surface temperatures in August at these sites are 32°C (90°F) and 38°C (100°F), respectively [16]

Recent studies suggest some populations are declining due to various factors, most notably global warming.[14] A 2003 study, published in the Journal of Mammalogy, showed nine of 25 sampled populations of American pika had disappeared in the Great Basin, leading biologists to conduct further investigations to determine if the species as a whole is vulnerable.[17]

In 2010, the US government considered, then decided not to add the American pika under the US Endangered Species Act;[18] in the IUCN Red List it is still considered a Species of Least Concern.[2]

The Pikas in Peril Project [19], funded through the National Park Service Climate Change Response Program, began data collection in May 2010. A large team of academic researchers and National Park Service staff are working together to address questions regarding the vulnerability of the American pika to future climate change scenarios projected for the western United States. The study is being carried out in eight parks, with results expected in 2012.

References

  1. ^ Hoffman, Robert S.; Smith, Andrew T. (16 November 2005). "Order Lagomorpha (pp. 185-211". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 191–192. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ a b Beever, E.A. & Smith, A.T. (2011). "Ochotona princeps". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/41267. Retrieved 18 January 2012.  Database entry includes a brief justification of why this species is of least concern.
  3. ^ "Pikas". World Wildlife Fund. http://www.worldwildlife.org/pikas/. Retrieved 2007-05-15. 
  4. ^ Mearns, B & R. John Kirk Townsend: Collector of Audubon’s Western Birds and Mammals. Page 108. Retrieved from [1] on 2009-10-06.
  5. ^ "Ochotona princeps". public.srce.hr. Archived from the original on 2005-03-18. http://web.archive.org/web/20050318232342/http://public.srce.hr/XIIIgim/pictures/pika/ochotona_princeps.html. Retrieved 2007-05-15. 
  6. ^ a b c "American Pika". NatureWorks. http://www.nhptv.org/natureworks/americanpika.htm. Retrieved 2007-05-15. 
  7. ^ a b c d e f g h i j k l m n o p q r s t u Smith, Andrew T.; Weston, Marla L. (1990-04-26). "Ochotona princeps". Mammalian Species (The American Society of Mammalogists) 352: 1–8. http://www.science.smith.edu/departments/Biology/VHAYSSEN/msi/pdf/i0076-3519-352-01-0001.pdf. Retrieved 2009-10-02. 
  8. ^ a b Hafner, D.J. (1993) "North American pika (Ochotona princeps) as a late Quaternary biogeographic indicator species". Quaternary Research, 39:373-380.
  9. ^ a b Martin, J. W. 1982. Southern pika (Ochotona princeps) biology and ecology: a literature review.
  10. ^ Erik A. Beever, Peter F. Brussard and Joel Berger (2003) "Patterns of apparent extirpation among isolated populations of pikas (Ochotona princeps) in the Great Basin", Journal of Mammalogy, 84(1):37–54.
  11. ^ a b c AT Smith (1974) "The Distribution and Dispersal of Pikas: Influences of Behavior and Climate". Ecology 55:1368–1376.
  12. ^ MM Peacock. 1997. "Determining natal dispersal patterns in a population of North American pikas (Ochotona princeps) using direct mark-resight and indirect genetic methods". Behavioral Ecology 8:340-350
  13. ^ Brown, Paul (August 21 2003). "American pika doomed as 'first mammal victim of climate change'". The Guardian (London). http://www.guardian.co.uk/climatechange/story/0,12374,1026312,00.html. Retrieved 2007-05-15. 
  14. ^ a b Blakemore, Bill (May 9 2007). "Route to Extinction Goes up Mountains, Scientists Say". World News with Charles Gibson. http://abcnews.go.com/WN/story?id=3155909&page=1. Retrieved 2007-05-15. 
  15. ^ http://www.worldwildlife.org/species/finder/americanpika/americanpika.html
  16. ^ Dept. of Interior, Fish and Wildlife Service, 12-month Finding on a Petition to List the American Pika as Threatened or Endangered
  17. ^ van Noordennen, Pieter (May 9 2007). "American Pika". GORP. http://www.gorp.com/weekend-guide/travel-ta-nature-ecotourism-mountain-west-sidwcmdev_060430.html. Retrieved 2007-05-15. 
  18. ^ Reis, Patrick (2010-02-05). "Obama Admin Denies Endangered Species Listing for American Pika". New York Times. http://www.nytimes.com/gwire/2010/02/05/05greenwire-obama-admin-denies-endangeres-species-listing-73387.html. Retrieved 2010-02-07. 
  19. ^ http://science.nature.nps.gov/im/units/ucbn/monitor/pika/pika_peril/index.cfm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Based on molecular phylogenetic studies, Hafner and Smith (2010) identified 5 lineages of Ochotona princeps; each of the following units was accepted as an evolutionarily meaningful unit and valid subspecies: O. p. princeps (Northern Rocky Mountains), O. p. fenisex (Coast Mountains and Cascade Range), O. p. saxatilis (Southern Rocky Mountains), O. p. schisticeps (Sierra Nevada and Great Basin), and O. p. uinta (Uinta Mountains and Wasatch Range of central Utah).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!