Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species occurs from central to eastern United States and into southeastern Canada; and westward to Wisconsin and south to Texas (Abbott, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

This is the only odonate in northeastern North America with entirely black wings (Nikula et al., 2003). Smoky rubyspot (Hetaerina titia) is the only other damselfly that may have completely dark wings. It lacks the blue-green iridescence on the body and the wings are only about a fifth as wide as long. In sparkling jewelwing (Calopteryx dimidiata) only the apical fourth of the wings are black (Abbott, 2007). In the south-central U.S., smoky rubyspot, Hetaerina titia, is the only other damselfly that may have completely dark wings. It lacks the blue-green iridescence on the body, and the wings are only about 1/5 as wide as long. In sparkling jewelwing, C. dimidiata, only the apical 1/4 of the wings is black (Abbott, 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species occurs in a variety of streams and small rivers but is most common along shallow forested streams. It tends to be found on smaller, more forested streams than the related river jewelwing, Calopteryx aequabilis (Nikula et al., 2003). Habitat generally consists of small, slow moving, canopy covered streams and occasionally exposed streams and rivulets. Nymphs are local in occurrence and restricted to slow creeks and quiet areas of running streams (Abbott, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: It is common throughout Massachusetts (Nikula et al., 2003). In Maine it has been found in every county across the state (Brunelle and deMaynadier, 2005). It is found in streams across Minnesota (Haarstad, 1997). In the south-central U.S., it occurs in the Arkansas, Bayou Bartholomew, Brazos, Canadian, Cimarron, Colorado, Mississippi, Neches, Ouachita, Red, Sabine, San Jacinto, St. francis, Trinity, and White River watersheds (Abbott, 2005). It was recently found in Fort Sill, Lawton, Camanche Co. Oklahoma (Zuellig et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Adults perch on streamside and emergent vegetation with a few feet of the water. They fly low over the water or along forest paths in a bouncy, butterfly-like manner (Nikula et al., 2003).

Flight period in Louisiana is March 1 to October 31 (Abbott, 2005). Westfall and May (2006) documented flight period from February 7 (Florida) to December 3 (Florida). In Cape Cod, Massachusetts, it is June-September (Carpenter, 1991). In Kansas it is May to September (Beckemeyer and Higgins, 1998). In Georgia it is from late March to early November (Beaton, 2007). In Ohio it is from May 5 to September 22 (Glotzhober and McShaffrey, 2002). In the western Great Lakes, it is mid-May to early September (DuBois, 2005). In Massachusetts, it it mid-May to mid-September (Nikula et al., 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males are territorial and perform fluttering courtship displays for females. Females oviposit in floating, emergent or submergent vegetation, often with the male guarding nearby (Nikula et al., 2003). Males will vigorously compete among themselves for territories with submergent vegetation, the prime egg-laying habitat for females. Males attract females with a "cross display," where the male faces the female with his hindwings deflected downward at right angles to his body, and the forewings and abdomen are raised, revealing the ventral pale area of the abdomen. The major ity of mating and egg laying occurs in the early afternoon and a single male may guard multiple females, resulting in sometimes large congregations. Females will lay their eggs in submergent vegetation for 10 to 120 minutes and usually don't submerge themselves. The displays and behaviors of northern and southern populations may differ (Abbott, 2007). For a summary of these behaviors the reader is directed to Dunkle (1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calopteryx maculata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 120 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACACTATATTTACTATTTGGGGCTTGAGCAGGAATAGTGGGAACAGCCTTAAGAATACTAATCCGTGTAGAACTCGGCCAACCCGGATCCCTAATTGGGGACGACCAAATCTATAATGTAGTAGTTACAGCACACGCTTTTGTTATAATTTTTTTCATAGTAATACCAATTATAATTGGTGGATTTGGAAACTGACTAGTACCCCTGATACTGGGGGCTCCTGATATGGCTTTCCCACGACTTAATAATATGAGATTTTGATTACTACCGCCCGCCTTGACCTTACTTCTAGCAAGAAGTTTAGTAGAAAGAGGGGCGGGGACCGGGTGGACCGTGTACCCCCCATTAGCGGGGGTAATTGGCCATGCGGGCGGGTCCGTTGACCTGACAATTTTCTCTTTACACTTAGCAGGCGTATCATCAATTTTGGGTGCAATCAACTTCATTACAACAACAATTAATATGAAGACCCCAGGAATAAAATTAGACCAAATACCATTGCTAGTGTGGGCAGTAGTAATCACAGCAGTTCTACTGCTACTATCCTTACCAGTCCTAGCAGGAGCTATTACTATATTACTGACCGACCGTAATATGAACACCTCATTTTTTGACCCTGCAGGGGGGGGAGACCCAATCCTATACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calopteryx maculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 115
Specimens with Barcodes: 119
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species occurs from central to eastern United States and into southeastern Canada; and westward to Wisconsin and south to Texas (Abbott, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ebony Jewelwing

The Ebony Jewelwing (Calopteryx maculata) is a species of broad-winged damselfly. It is one out of the 170 species of the Odonata found in New England, the Mid-Atlantic states, and southeastern Canada.

Description[edit]

It is between 39–57 mm (1.5–2.2 in). The male has a metallic blue-green body and black wings. The female is duller brown with smoky wings that have white spots near the tips. The naiad is pale brown with darker markings.[1]

Habitat[edit]

It lives near wooded streams and rivers, but it can move far from water.[2]

Breeding[edit]

Mating

Ebony Jewelwings mate in the summer. The male holds the female behind her head with his tail or abdomen. The female lays eggs in the soft stems of aquatic plants. The naiad eats small aquatic insects. When the naiad is fully grown, it crawls out of the water and molts.[3]

Flight season[edit]

This damselfly species can be seen almost year-round in some regions.[4]

Ecology[edit]

Prey of this species includes[3] the tiger mosquito, giant willow aphid, fungus gnats, crane flies, large diving beetles, eastern dobsonfly, water flea, green darner, aquatic oligochaetes, caddisflies, rotifers, copepods, amphipods, dogwood borer, six-spotted tiger beetle, freshwater triclads, and green hydra.

Predators of this damselfly include[3] birds such as the Great Crested Flycatcher, American Robin, Mallard, Red-winged Blackbird, and Blue Jay, reptiles and amphibians such as the eastern painted turtle, common snapping turtle, and southern leopard frog, fish such as the bluegill, largemouth bass, yellow perch, creek chub, channel catfish, common carp, and northern hogsucker, mammals such as the big brown bat, and insects such as the green darner, large diving beetles, eastern dobsonfly, and common water strider.

The damselfly shelters among various plants and algaes in its habitat, including[3] green algae, yellow water lily, hydrilla, lizard's tail, pickerelweed, common cattail, upright sedge, common bladderwort, common duckweed, black willow, orange jewelweed, spotted Joe-pye weed, poison ivy, wild grape, sassafras, common greenbrier, and buttonbush.

References[edit]

  1. ^ Lam, Ed. (2004) Damselflies of the Northeast. Forest Hills, NY: Biodiversity Press, p.20.
  2. ^ Species Calopteryx maculata - Ebony Jewelwing, BugGuide
  3. ^ a b c d Ebony Jewelwing, Study of Northern Virginia Ecology. Fairfax County Public Schools.
  4. ^ Ebony Jewelwing. The Dragonflies and Damselflies of New Jersey.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subspecies C. m. floridana was described by Huggins (1927) based on Florida specimens. However, Byers (1930) concluded that naming subspecies was not feasible without further study (Westfall and May 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!