Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species occurs from central to eastern United States and into southeastern Canada; and westward to Wisconsin and south to Texas (Abbott, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

This is the only odonate in northeastern North America with entirely black wings (Nikula et al., 2003). Smoky rubyspot (Hetaerina titia) is the only other damselfly that may have completely dark wings. It lacks the blue-green iridescence on the body and the wings are only about a fifth as wide as long. In sparkling jewelwing (Calopteryx dimidiata) only the apical fourth of the wings are black (Abbott, 2007). In the south-central U.S., smoky rubyspot, Hetaerina titia, is the only other damselfly that may have completely dark wings. It lacks the blue-green iridescence on the body, and the wings are only about 1/5 as wide as long. In sparkling jewelwing, C. dimidiata, only the apical 1/4 of the wings is black (Abbott, 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species occurs in a variety of streams and small rivers but is most common along shallow forested streams. It tends to be found on smaller, more forested streams than the related river jewelwing, Calopteryx aequabilis (Nikula et al., 2003). Habitat generally consists of small, slow moving, canopy covered streams and occasionally exposed streams and rivulets. Nymphs are local in occurrence and restricted to slow creeks and quiet areas of running streams (Abbott, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: It is common throughout Massachusetts (Nikula et al., 2003). In Maine it has been found in every county across the state (Brunelle and deMaynadier, 2005). It is found in streams across Minnesota (Haarstad, 1997). In the south-central U.S., it occurs in the Arkansas, Bayou Bartholomew, Brazos, Canadian, Cimarron, Colorado, Mississippi, Neches, Ouachita, Red, Sabine, San Jacinto, St. francis, Trinity, and White River watersheds (Abbott, 2005). It was recently found in Fort Sill, Lawton, Camanche Co. Oklahoma (Zuellig et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Adults perch on streamside and emergent vegetation with a few feet of the water. They fly low over the water or along forest paths in a bouncy, butterfly-like manner (Nikula et al., 2003).

Flight period in Louisiana is March 1 to October 31 (Abbott, 2005). Westfall and May (2006) documented flight period from February 7 (Florida) to December 3 (Florida). In Cape Cod, Massachusetts, it is June-September (Carpenter, 1991). In Kansas it is May to September (Beckemeyer and Higgins, 1998). In Georgia it is from late March to early November (Beaton, 2007). In Ohio it is from May 5 to September 22 (Glotzhober and McShaffrey, 2002). In the western Great Lakes, it is mid-May to early September (DuBois, 2005). In Massachusetts, it it mid-May to mid-September (Nikula et al., 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males are territorial and perform fluttering courtship displays for females. Females oviposit in floating, emergent or submergent vegetation, often with the male guarding nearby (Nikula et al., 2003). Males will vigorously compete among themselves for territories with submergent vegetation, the prime egg-laying habitat for females. Males attract females with a "cross display," where the male faces the female with his hindwings deflected downward at right angles to his body, and the forewings and abdomen are raised, revealing the ventral pale area of the abdomen. The major ity of mating and egg laying occurs in the early afternoon and a single male may guard multiple females, resulting in sometimes large congregations. Females will lay their eggs in submergent vegetation for 10 to 120 minutes and usually don't submerge themselves. The displays and behaviors of northern and southern populations may differ (Abbott, 2007). For a summary of these behaviors the reader is directed to Dunkle (1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calopteryx maculata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 120 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACACTATATTTACTATTTGGGGCTTGAGCAGGAATAGTGGGAACAGCCTTAAGAATACTAATCCGTGTAGAACTCGGCCAACCCGGATCCCTAATTGGGGACGACCAAATCTATAATGTAGTAGTTACAGCACACGCTTTTGTTATAATTTTTTTCATAGTAATACCAATTATAATTGGTGGATTTGGAAACTGACTAGTACCCCTGATACTGGGGGCTCCTGATATGGCTTTCCCACGACTTAATAATATGAGATTTTGATTACTACCGCCCGCCTTGACCTTACTTCTAGCAAGAAGTTTAGTAGAAAGAGGGGCGGGGACCGGGTGGACCGTGTACCCCCCATTAGCGGGGGTAATTGGCCATGCGGGCGGGTCCGTTGACCTGACAATTTTCTCTTTACACTTAGCAGGCGTATCATCAATTTTGGGTGCAATCAACTTCATTACAACAACAATTAATATGAAGACCCCAGGAATAAAATTAGACCAAATACCATTGCTAGTGTGGGCAGTAGTAATCACAGCAGTTCTACTGCTACTATCCTTACCAGTCCTAGCAGGAGCTATTACTATATTACTGACCGACCGTAATATGAACACCTCATTTTTTGACCCTGCAGGGGGGGGAGACCCAATCCTATACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calopteryx maculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 115
Specimens with Barcodes: 119
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species occurs from central to eastern United States and into southeastern Canada; and westward to Wisconsin and south to Texas (Abbott, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ebony Jewelwing

The Ebony Jewelwing (Calopteryx maculata) is a species of broad-winged damselflies. It is one out of the 170 species of the Odonata found in New England, the Mid-Atlantic states, and southeastern Canada.

Contents

Identification

It is between 39–57 mm (1.5–2.2 in). The males have metallic blue-green bodies and black wings. Females have duller brown bodies and smoky wings and glistening white spots near tip wings. Naiad have pale brown bodies with darker markings.[1]

Habitat

male and female

It lives near wooded streams and rivers. Ebony Jewelwings flutter like a butterfly. When disturbed they fly a short distance to safety. These damselflies are easy to get close to as long as you approach slowly and don't make any sudden movements. They will often stop to rest on leaves or twigs. Ebony Jewelwings may fly far from water. They can be seen in the middle of the woods, while most damselflies and dragonflies are usually seen near ponds, lakes, or rivers.[2]

Breeding

Ebony Jewelwings mating

Ebony Jewelwings mate in the summer. The male grabs the female behind her head with his tail or abdomen. After mating, females lay their eggs inside soft stems of water plants. Eggs hatch into larvae called naiads. Ebony Jewelwing naiads eat small aquatic insects. When the naiads are fully grown, they crawl out of the water and molt. They leave their old skin behind. The adult can soon fly off and look for a mate.[3]

Distribution

Its found throughout most of the United States (except 15 of the states) and southern Canada.

Flight season

This damselfly species is can be seen almost all year round in some regions. [4]

Prey

The Ebony Jewelwing has a wide variety of prey, including:[3] Asian Tiger Mosquito, Giant Willow Aphid, Fungus Gnat, Crane Fly, Large Diving Beetle, Eastern Dobsonfly, Water Flea, Green Darner, Aquatic Worm, Northern caddis fly, Rotifer, Copepod, Scud, Dogwood Borer, Six-spotted Tiger Beetle, Flatworm, and Green Hydra

Predators

The damselfly also has many predators, including:[3] Great Crested Flycatcher, American Robin, Big Brown Bat, Green Darner, Large Diving Beetle, Eastern Dobsonfly, Mallard, Eastern Painted Turtle, Bluegill, Largemouth Bass, Yellow Perch, Creek Chub, Channel Catfish, Red-winged Blackbird, Blue Jay, Common Snapping Turtle, Southern Leopard Frog, Common Carp, Common Water Strider, and Northern hogsucker

Shelter plants

The Ebony Jewelwing has many plants it uses for shelter. The following is list of plants.[3] Yellow Pond Lily, Hydrilla, Lizard's Tail, Green Algae, Pickerelweed, Common Cattail, Tussock Sedge, Greater Bladderwort, Common Duckweed, Black Willow, Spotted Jewelweed, Spotted Joe-pye Weed, Poison Ivy, Wild Grape[disambiguation needed], Sassafras, Greenbrier, and Buttonbush[disambiguation needed]

Relationship to humans

Like other damselflies they help people by eating large numbers of pesky insects, including mosquitoes, common houseflies, and other unwanted insects.[3]

References

  1. ^ Lam, Ed. Damselflies of the Northeast. Forest Hills, NY:Biodiversity Press, 2004.
  2. ^ http://bugguide.net/node/view/601
  3. ^ a b c d e www.fcps.edu/islandcreekes/ecology/ebony_jewelwing.htm
  4. ^ http://www.njodes.com/Speciesaccts/bwdamsels/jewe-ebon.asp
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subspecies C. m. floridana was described by Huggins (1927) based on Florida specimens. However, Byers (1930) concluded that naming subspecies was not feasible without further study (Westfall and May 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!