Molecular Biology and Genetics

Molecular Biology

Barcode data: Parnassius acco

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATGGGAGAT---GATCAAATTTATAATACTATCGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAACAATATAAGATTTTGGTTATTACCTCCTTCATTAACTTTATTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACGGTTTACCCTCCTTTATCATCTAATATGGCTCATGGAGGAAGATCAGTTGATTTAGCTATTTTTTCTTTACTTTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATCATATATCATTTGATCAAATACCTCTTTTCGTATGAGCAGTAGGAATTACTGCTTTACTTTTATTATTATCCTTACCTGTTTTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATCTTAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCACNNNGAAGTTTATATTTTAATTTTACCTGGATTTGGTATAATTTCTCATATTATTTCACAAGAAAGTGGAAAAAAAGAAACTTTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGAATAGATATTGATACTCGAGCTTATTTTACTTCTGCAACTATAATTATTGCTGTACCTACAGGAATTAAAATTTTTAGTTGATTAGCAACCTTACATGGATCT---CAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parnassius acco

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Parnassius acco

Varnished Apollo Parnassius acco is a high altitude butterfly which is found in Asia. It is a member of the Snow Apollo genus Parnassius of the Swallowtail (Papilionidae) family.

Contents

Description

Note. The wing pattern in Parnassius species is inconsistent and the very many subspecies and forms make identification problematic and uncertain. Structural characters derived from the genitalia, wing venation, sphragis and foretibial epiphysis are more, but not entirely reliable. The description given here is a guide only.For an identification key see Ackery P.R. (1975[1]

Upperside: dull greyish white. Fore wing: costal margin and base with an irroration of black scales, the white scaling clearest and most dense in the cell, this last crossed by a medial and an apical short, broad, transverse jet-black band; beyond apex of cell an irregularly sinuous dusky-black discal band that, usually extends from costa to vein 3, but in some specimens right up to the dorsal margin, in most it bears an anterior crimson spot; this is followed by less irregular and, in most specimens, slightly broader postdiscal and terminal similar transverse bands and a pre-ciliary slender continuous line on termen and dorsum. Hind wing: dorsal half of the wing dusky black, the outer or upper margin of this colour, irregularly indented; a discal, a subcostal and a basal black-encircled spot that varies in colour from crimson to pinkish yellow, followed by a subterminal series of black lunular spots and a narrow terminal band, crossed and interrupted by the white veining. Cilia of both wings conspicuously white. Underside with a glassy appearance. Forewing nearly as on the upperside, but the black markings, except the two bars across the cell, only seen through by transparency from the upperside. Hind wing : ground-colour white, the discal, costal, and basal pink or crimson spots also apparently transparency only from the upperside; a discal double ill-defined series of black lunular markings, followed by a subterminal series of similar markings like those on the upperside, but of a duller black and less clearly defined. Antennae dull brownish black, with a more or less copious covering of scattered white scales; abdomen black, clothed with somewhat sparse, long, fine white hairs.[2]

Range

Pakistan, Kashmir, Himachal Pradesh and further East to Sikkim, Nepal and China.

Status

Very rare. Inadequately known. More information is needed from the Indian highlands and Tibet. The subspecies P. a. geminifer is protected by law in India.[3]

See also

Cited references

  1. ^ Ackery P.R. (1975) A guide to the genera and species of Parnassiinae (Lepidoptera:Papilionidae). Bull. Br. Mus. nat. Hist. (Ent.) 31, 4 pdf
  2. ^ Bingham, C. T. 1907. Fauna of British India. Butterflies. Volume 2
  3. ^ Collins, N.M., Morris, M.G. (1985) Threatened Swallowtail Butterflies of the World. IUCN. ISBN 2-88032-603-6

Other references

  • Evans, W.H., (1932) The Identification of Indian Butterflies (2nd Ed), Bombay Natural History Society, Mumbai, India
  • Haribal, Meena., (1992) The Butterflies of Sikkim Himalaya.Sikkim Nature Conservation Foundation, Gangtok
  • Sakai S., Inaoka S., Toshiaki A., Yamaguchi S., Watanabe Y., (2002) The Parnassiology. The Parnassius Butterflies, A Study in Evolution, Kodansha, Japan. ISBN 4-06-124051-X
  • Weiss, J.-C., (1992) Parnassiinae of the World - Part 2, Sciences Nat, Venette, France. ISBN 0-9532240-2-3
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Parnassius przewalskii

Parnassius przewalskii is a high altitude butterfly which is found in Tibet and West China. It is a member of the Snow Apollo genus Parnassius of the Swallowtail (Papilionidae) family.

The taxonomic status of this butterfly is uncertain.It was described as a species but some authors regard P. przewalskii as a subspecies of Parnassius acco.

The species is named for Nikolai Przhevalsky.

References

  • Weiss, J.-C. 1992. The Parnassiinae of the World, Part 2. Sciences Nat, Venette; 87 pp.
  • Chou, I. (ed) 1994. Monographia Rhopalocerorum Sinensium (Monograph of Chinese Butterflies). Henan Scientific and Technological Publishing House, Zhengzhou.(in Chinese)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!