Molecular Biology and Genetics

Molecular Biology

Barcode data: Parnassius epaphus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGTACTGAATTAGGTAATCCTGGATCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGAATAAACAATATAAGATTTTGATTATTACCCCCCTCATTAACTTTATTAATTTCCAGAAGTATCGTCGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCTTTATCATCTAATATTGCTCATGGAGGTAGCTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCTATCTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTCTTTTTGTCTGAGCAGTAGGAATTACCGCTTTACTTTTATTATTATCTTTACCTGTTTTAGCAGGTGCTATTACAATACTTCTAACAGATCGAAATCTTAATACCTCATTTTTTGATCCTGCAGGAGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCACNNNNNNGTTTATATTTTAATTTTACCTGGTTTCGGAATAATTTCTCATATTATTTCTCAAGAAAGTGGAAAAAAAGAAACTTTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGAATAGATATTGATACTCGAGCTTATTTTACTTCTGCAACTATAATTATTGCTGTACCAACAGGTATTAAAATTTTTAGTTGATTAGCAACATTACATGGATCT---CAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Parnassius epaphus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Parnassius epaphus

Common Red Apollo Parnassius epaphus is a high altitude butterfly which is found in India and Nepal. It is a member of the Snow Apollo genus Parnassius of the Swallowtail (Papilionidae) family. This handsome butterfly is found from 9,000 to 13,000 ft from Chitral District to Sikkim and Western regions of Nepal. It is Not Rare.

Description[edit source | edit]

For terms used in the description see glossary of Lepidopteran terms

Superficially this form closely resembles Parnassius jacquemontii, but besides the structural differences of the anal pouch in the fertilized female, in markings it differs as follows:

Race abruptus specimen from Kansu in the Ulster museum

Male Upperside, fore wing: the crimson black-encircled spots reduced to a minute subcostal dot in the black mark beyond the cell; the subhyaline terminal margin much narrower, with dentate white spots in the interspaces along the actual margin; cilia white, markedly alternated with black at the apices of the veins. Hind wing: the dusky black along the dorsal margin comparatively much broader, its inner border more irregular, deeply bi-emarginate, the crimson centre to the black mark above the tornal angle entirely absent. In no specimens that I have seen are the crimson spots centred with white. Underside: with the same glazed appearance as in jacquemontii; markings as on the upperside, but on the fore wing the white dentate spots in the terminal row are larger, which give to the wing the appearance of having a subterminal as well as a post-discal transverse series of dusky-black lunules. On the hind wing the row of basal and the obliquely-placed pre-tornal spots are as in jacquemontii but of a duller shade, while as in that form all the crimson spots are broadly centred with white. Antennae differ from those of jacquemonti as they are conspicuously ringed with white. Female differs from the male in the dusky black markings on the upperside that are broader, especially the postdiscal series on the fore wing: this generally forms a diffuse band and so often restricts the lunules of the white ground-colour beyond it, blending as it does diffusely with the subhyaline terminal margin. Anal pouch of fertilized female differs conspicuously from that of jacquemontii female in the complete absence of the posterior high keel or carina.[1]

Range[edit source | edit]

Afghanistan, Pakistan, Tadzikistan, Northern Republic of India (Himalayas and Sikkim), Nepal, Bhutan and China - Tibet, Singkiang, Kansu, Tshingai, Szechwan. [2] Fairly broadly distributed.

Status[edit source | edit]

It is broadly distributed across Asia and not known to be threatened. The subspecies P. e. hillensis is protected by law in India.[3]

See also[edit source | edit]

Cited references[edit source | edit]

  1. ^ Bingham, C. T. 1907. Fauna of British India. Butterflies. Volume 2
  2. ^ http://goran.waldeck.se/paindex2.htm
  3. ^ Collins, N.M., Morris, M.G. (1985) Threatened Swallowtail Butterflies of the World. IUCN. ISBN 978-2-88032-603-6

Other references[edit source | edit]

  • Evans, W.H., (1932) The Identification of Indian Butterflies (2nd Ed), Bombay Natural History Society, Mumbai, India
  • Sakai S., Inaoka S., Toshiaki A., Yamaguchi S., Watanabe Y., (2002) The Parnassiology. The Parnassius Butterflies, A Study in Evolution, Kodansha, Japan.
  • Weiss J.-C., (2005) Parnassiinae of the World - Part 4, Hillside Books, Canterbury, UK.[1]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!