Molecular Biology and Genetics

Molecular Biology

Barcode data: Parnassius apollonius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGTACTGAATTAGGTAATCCTGGATCTTTAATTGGAGAT---GATCAAATCTATAACACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCACCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCATTAACTCTACTAATTTCTAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCTTTATCCTCTAATATTGCTCATGGAGGTAGTTCAGTTGATTTAGCCATTTTTTCACTACATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTCTTTTTGTTTGAGCAGTAGGAATTACAGCTTTACTTTTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACAATACTTTTAACAGATCGAAATCTTAATACTTCATTTTTTGATCCAGCAGGAGGTGGAGATCCTATTTTATATCAACATTTATTCTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCTGGTTTCGGAATAATTTCACATATTATTTCTCAAGAAAGTGGAAAAAAAGAAACTTTTGGATGCTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGAATAGATATTGATACTCGAGCTTATTTTACTTCTGCAACTATAATTATTGCTGTACCAACAGGAATTAAAATTTTTAGTTGATTAGCAACATTACATGGATCT---CAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parnassius apollonius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Parnassius apollonius

Parnassius apollonius and allied species

Parnassius apollonius is a member of the Snow Apollo genus Parnassius of the Swallowtail (Papilionidae) family. It is found in Central and South Kazakhstan, the South Altai, Saur, Tarbagatai, Dzhungarsky Alatau, Tian-Shan, Ghissar-Darvaz, the Pamirs-Alai and West China.[2]

This species is found from a broad altitudinal zone (500 m to 3,000 m). Adults fly over dry mountain slopes in May–July depending on the altitude.[2]

Larval host plants include Pseudosedum, and Rosularia spp.[2]

Diagnostic description[edit]

Note. The wing pattern in Parnassius species is inconsistent and the very many subspecies and forms make identification problematic and uncertain. Structural characters derived from the genitalia, wing venation, sphragis and foretibial epiphysis are more, but not entirely reliable. The description given here is a guide only.For an identification key see Ackery P.R. (1975[3]

P. apollonius is recognizable especially by the sharply defined black submarginal spots of both wings; moreover, in males there is hardly a distinct greyish vitreous marginal band, the edge being however a little more sparsely scaled with white than the disc and only anteriorly shaded with grey. Arrangement of spots as in the allied species; 3 costal spots beyond the cell, the central one being usually vestigial, the proximal or the distal one or both centred with red, the hindmarginal spot rarely quite black.Hindwing with red basal spot; the abdominal area deep black, anal spots present; on the underside 3 red basal spots, one of them situated behind the cell, being much more distal than the others and more feebly marked. Female washed with blackish grey, almost transparent, costal and hindmarginal spots of forewing more broadly filled in with red; hindwing without black abdominal area, being here only dusted with black as on disc. Antenna and abdomen black above, the latter sparsely clothed with white hairs.[4]

Subspecies[edit]

Museum specimens of Parnassius apollonius

There are many subspecies. The better described ones include[2]

  • poseidon Bryk et Eisner, 1934 (Region: W. Tian-Shan)
  • glaucopis Bryk et Eisner, 1934 (Region: S. Kazakhstan)
  • gloriosus Fruhstorfer, 1904 (Region: N. Tian-Shan)
  • narynus Fruhstorfer, 1908 (Region: Inner Tian-Shan)
  • alpinus Staudinger, 1887 (Region: Alai)
  • daubi Fruhstorfer, 1903 (Region: Ghissar)
  • nominate found in S. Altai, Saur, Tarbagatai and Dzhungarsky Alatau
  • aphrodite Bryk et Eisner, 1934 (Region: Ili River valley)

References[edit]

  1. ^ Eversmann, Bull. Soc. Imp. Nat. Mosc. 1847 p. 71
  2. ^ a b c d P. V. Bogdanov, A. L. Devyatkin, L. V. Kabak, V. A. Korolev, V. S. Murzin, G. D. Samodurov, E. A. Tarasov, and V. K. Tuzov (1997) Guide to the butterflies of Russia and adjacent territories (Lepidoptera, Rhopalocera). Volume 1: Hesperiidae, Papilionidae, Pieridae, Satyridae. Pensoft. ISBN 954-642-018-2
  3. ^ Ackery P.R. (1975) A guide to the genera and species of Parnassiinae (Lepidoptera:Papilionidae). Bull. Br. Mus. nat. Hist. (Ent.) 31, 4 pdf
  4. ^ Stichel in Seitz, 1906 (Parnassius). Die Groß-Schmetterlinge der Erde. Die Groß-Schmetterlinge des palaearktischen Faunengebietes. Die palaearktischen Tagfalter, Stuttgart.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!