Molecular Biology and Genetics

Molecular Biology

Barcode data: Parnassius acdestis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGTACTGAATTAGGTAACCCTGGATCTTTAATTGGGGAT---GATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATCCCTTTAATATTAGGGGCTCCAGATATAGCCTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTTTAACTTTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCTTTATCATCTAATATTGCCCATGGAGGAAGATCAGTTGACTTAGCTATTTTTTCCTTACATTTAGCTGGAATCTCTTCTATTTTAGGAGCTATCAATTTTATTACAACTATTATTAATATGCGAATTAATCACATATCATTTGATCAAATACCCCTTTTTGTTTGAGCAGTTGGAATTACCGCTTTACTTTTATTATTATCCTTGCCCGTTTTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATCTTAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCACNNNGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCACATTATCTCCCAAGAAAGTGGAAAAAAGGAAACTTTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTATTGTATGAGCTCATCATATATTCACAGTTGGAATAGATATTGATACTCGAGCTTATTTCACTTCTGCAACTATAATTATTGCTGTACCAACAGGAATTAAAATTTTTAGTTGATTAGCAACATTACACGGATCA---CAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parnassius acdestis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Parnassius acdestis

Parnassius acdestis is a high-altitude butterfly found in India. It is a member of the genus Parnassius of the swallowtail (Papilionidae) family.

Contents

Description

Note. The wing pattern in Parnassius species is inconsistent and the very many subspecies and forms make identification problematic and uncertain. Structural characters derived from the genitalia, wing venation, sphragis and foretibial epiphysis are more, but not entirely reliable. The description given here is a guide only.For an identification key see Ackery P.R. (1975[1]

Hindwing with very narrow marginal band, the submarginal spots isolated, small; the ultracellular costal spot of forewing continued by grey scaling, forming an S-shaped band. [2]


Range

Kirghistan, Nepal, northern India (Jammu & Kashmir, Sikkim), Western China, Sinkiang and Szechwan.

Status

Very local. Rather Rare. Not known to be threatened.

See also

References

  1. ^ Ackery P.R. (1975) A guide to the genera and species of Parnassiinae (Lepidoptera:Papilionidae). Bull. Br. Mus. nat. Hist. (Ent.) 31, 4 pdf
  2. ^ Stichel in Seitz, 1906 (Parnassius). Die Groß-Schmetterlinge der Erde. Die Groß-Schmetterlinge des palaearktischen Faunengebietes. Die palaearktischen Tagfalter, Stuttgart.
  • Collins, N.M., Morris, M.G. (1985) Threatened Swallowtail Butterflies of the World. IUCN. ISBN 2-88032-603-6
  • Evans, W.H., (1932) The Identification of Indian Butterflies (2nd Ed), Bombay Natural History Society, Mumbai, India
  • Wynter-Blyth, M.A., (1957) Butterflies of the Indian Region, Bombay Natural History Society, Mumbai, India.
  • Sakai S., Inaoka S., Toshiaki A., Yamaguchi S., Watanabe Y., (2002) The Parnassiology. The Parnassius Butterflies, A Study in Evolution, Kodansha, Japan. ISBN 4-06-124051-X
  • Weiss Jean-Claude, (1999) Parnassiinae of the World, Hillside Books, Canterbury, UK. ISBN 0-9532240-2-3, OCLC 41072974
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!