Overview

Brief Summary

The Clouded Apollo occurs in rocky regions on damp to moderately dry grasslands and sparse deciduous woodland, forest clearings and edges in the neighborhood of large stands of the larval foodplants of the genus Corydalis. The butterflies can often be seen nectaring on red or purple flowers. Larvae are usually found feeding on foodplants that occur on sunny margins or clearings in the forests. The egg hibernates. In spring, as soon as it has hatched, the small caterpillar starts its search for a suitable foodplant. When fully-grown, it pupates in a closely spun cocoon of fine threads, situated above the ground in the leaves of the foodplant or litter. The Clouded Apollo has one generation a year. Habitats: broad-leaved deciduous forests (22%), alpine and subalpine grasslands (19%), mesophile grasslands (14%), humid grasslands and tall herb communities (10%), mixed woodland (8%), dry calcareous grasslands and steppes (8%).

  • Bergström A (2005) Oviposition site preferences of the threatened butterfly Parnassius mnemosyne – implications for conservation. Journal of Insect Conservation 9: 21-27. doi: 10.1007/s10841-004-3204-4
  • Brommer JE, Fred MS (1999) Movement of the Apollo butterfly Parnassius apollo related to host plant and nectar plant patches. Ecological Entomology 24: 125-131.
  • Gorbach VV, Kabanen DN (2010) Spatial organization of the Clouded Apollo population (Parnassius mnemosyne) in Onega Lake Basin. Entomological Review 90: 11-22.
  • Gratton P, Konopinski MK, Sbordoni V (2008) Pleistocene evolutionary history of the Clouded Apollo (Parnassius mnemosyne): genetic signatures of climate cycles and a ‘time-dependent’ mitochondrial substitution rate. Molecular Ecology 17: 4248-4262. doi: 10.1111/j.1365-294X.2008.03901.x
  • Konvička M, Duchoslav M, Haraštová M, Beneš J, Foldynová S, Jirku M, Kuras T (2001) Habitat utilization and behaviour of adult Parnassius mnemosyne (Lepidoptera: Papilionidae) in the Litovelské Pomoraví, Czech Republic. Nota lepidopterologica 24: 39-51.
  • Konvička M, Kuras T (1999) Population Structure, Behaviour and Selection of Oviposition Sites of an Endangered Butterfly, Parnassius mnemosyne, in Litovelské Pomoravíl. Czech Republic. Journal of Insect Conservation 3: 211-223. doi: 10.1023/a:1009641618795
  • Konvička M, Vlasanek P, Hauck D (2006) Absence of forest mantles creates ecological traps for Parnassius mnemosyne (Papilionidae). Nota lepidopterologica 29: 145-152.
  • Luoto M, Kuussaari M, Rita H, Salminen J, von Bonsdorff T (2001) Determinants of distribution and abundance in the clouded apollo butterfly: a landscape ecological approach. Ecography 24: 601-617.
  • Meglecz E, Nève G, Pecsenye K, Varga Z (1999) Genetic variations in space and time in Parnassius mnemosyne (L.) (Lepidoptera) populations in north-east Hungary: implications for conservation. Biological Conservation 89: 251-259.
  • Välimäki P, Itämies J (2003) Migration of the clouded Apollo butterfly Parnassius mnemosyne in a network of suitable habitats - effects of patch characteristics. Ecography 26: 679-691
Creative Commons Attribution 3.0 (CC BY 3.0)

© Chris van Swaay

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Supplier: Kristen Lans

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Parnassius mnemosyne

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 101 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTTCCTCGAATAAATAATATAAGATTTTGATTACTACCCCCCTCATTAACTTTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTTTATCATCTAATATCGCTCATAGAGGTAGTTCAGTTGATTTA---GCTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATCTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAACCATATATCATTTGATCAAATACCTCTCTTTGTATGAGCAGTAGGAATTACTGCTTTACTTTTATTATTATCTTTACCTGTATTAGCTGGT---GCTATTACTATATTATTAACAGATCGAAATCTTAATACTTCATTTTTTGATCCTGCAGGAGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGGATAATCTCTCATATTATTTCTCAAGAAAGTGGAAAAAAA---GAAACTTTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAGATATTGATACCCGAGCTTATTTTACTTCTGCAACTATAATTATTGCTGTACCAACAGGAATTAAAATTTTTAGTTGATTA---GCAACATTACACGGATCT---CAAATTAATTATAGCCCATCTATCTTATGAAGATTAGGATTTGTTTTTTTATTTACAGTAGGGGGATTAACAGGAGTAATTTTAGCTAATTCTTCAATTGATGTAACATTACATGATACTTATTATGTTGTAGCTCATTTCCACTATGTT---TTATCTATAGGAGCAGTATTTGCAATTATAGGAGGATTTATTCATTGATATCCTTTATTTACAGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Parnassius mnemosyne

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 102
Specimens with Barcodes: 131
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Clouded apollo

The Clouded Apollo (Parnassius mnemosyne) is a butterfly species of the family of Swallowtail butterflies (Papilionidae) found in Eurasia.

Clouded Apollos inhabit meadows and woodland clearings with plenty of flowering plants, both in the lowlands and in the mountains. It is not usually found at altitudes above 1500m except in the Asian mountains where it is known also from higher altitudes.

Distribution[edit]

Its range of distribution extends from the Pyrenees, across the Central Massif, the Alps, and the Carpathians as far as central Asia. It inhabits all European countries including Norway, where it appears rarely and only in certain places. A special subspecies lived in Denmark, but is now extinct. A great number of different geographical races and individual forms are distinguished in this extensive region. The most striking specimens include the dark race from the eastern Bavarian Alps (ssp. hartmanni ); form melania has the most pronounced dark colouring. The paper of Dr. I.N. Bolotov and colleagues (2013) summarizes data on the northern localities of Parnassius mnemosyne (L.), which are mostly situated in the Russian Federation and gives a thorough description of the species' northern range location.[1] It is shown that the northernmost populations in the exist within the karst landscapes in the North of White Sea-Kuloi Plateau (between 65°35' and 66°03' N) in the downstream of the Soyana and Kuloi rivers and in the north of Timan Highland (66°10' N) along the shore of Kosminskoe Lake (the Pechora river basin). Northern limits of the Clouded Apollo's range appear to be strongly determined by the distribution of its larval host plants (primarily Corydalis solida (L.) Clairv.; Papaveraceae) and the role of climate and relief seem to be of minor importance. Many Russian populations inhabit the state nature reserve territories: "Kizgi Scerries" Reserve (Karelia Republic), Pinega and Soyansky Reserves (Arkhangelsk oblast), Pechoro-Ilychsky and "Belaja Kedva" Reserves (Komi Republic).

Habits[edit]

The Clouded Apollo is locally common in some places in central Europe. The female lays whitish eggs with a granular surface. The caterpillar feeds only on sunny days, otherwise it is hidden under leaves or stones. The blunt-ended chrysalis lies on the ground in a light spun covering. The caterpillars feed exclusively on Corydalis species.[2] To prevent the continuing disappearance of this butterfly from many places in central Europe, it is now protected in some regions. They inhabit small patches and individuals move from patch to patch and conservation of a network of patches is required to maintain the genepool.[3]

References[edit]

  1. ^ Bolotov I.N., Gofarov M.Y., Rykov A.M., Frolov A.A., Kogut Y.I. 2013. Northern boundary of the range of the Clouded Apollo butterfly Parnassius mnemosyne (L.) (Papilionidae): climate influence or degradation of larval host plants? – Nota lepid. 36 (1): 19–33.
  2. ^ HANSEN Lars Ove and AARVIK Leif, Trondheim. 2004 CLOUDED APOLLO - Parnassius mnemosyne (Linnaeus, 1758), data sheet in Lepidoptera of Norway
  3. ^ VÄLIMÄKI Panu, ITÄMIES, Juhani. 2003 Migration of the clouded Apollo butterfly Parnassius mnemosyne in a network of suitable habitats: effects of patch characteristics. Ecography 26(5):679-691
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!