Overview

Brief Summary

North American Ecology (US and Canada)

Resident in North America east of the Rockies (Scott 1986). Habitats are WOODS, MOUNTAINS AND SUBURBS. Host plants include many species, but mostly in one family, Umbelliferae. Hosts are usually herbaceous. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There are a variable number of flights based on latitude with the approximate flight time MAY15-JUN30 in the northern part of the range and JAN1-DEC31 in the southern part of their range (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The range of black swallowtails (also known as American swallowtails) extends from Southern Canada, through North America, and down to South America. Included in the South American range are the West Indies. In North America, black swallowtails are not commonly found west of the Rocky Mountains.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Ehrlich, P. 1961. How to Know Butterflies. Dubuque, Iowa: WM. C. Brown Company Publishers.
  • Neck, R. 1996. Butterflies of Texas. Houston, Texas: Gulf Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) United States and southern Canada east of the Rockies; and Arizona, New Mexico, southern California, south into Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

The range of black swallowtails (also known as American swallowtails) extends from Southern Canada, through North America, and down to South America. Included in the South American range are the West Indies. In North America, black swallowtails are not commonly found west of the Rocky Mountains.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Ehrlich, P. 1961. How to Know Butterflies. Dubuque, Iowa: WM. C. Brown Company Publishers.
  • Neck, R. 1996. Butterflies of Texas. Houston, Texas: Gulf Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult black swallowtails range in length from seven to nine cm, and can reach a wingspan of 11.5 cm. Older larva vary from green to yellow and most often each segment is crossed by a black band. Pupae of this species can vary from green and yellow, to brown and white, to a black form.

The upper surface of an adult is black with two rows of yellow spots. In females these yellow spots are narrow and lighter, or nonexistent. On the upper surface of the adults' hind wing, there are irridescent blue spots on males and an irridescent blue band on females. On the upperside of the hindwing there is a large red spot that has a black center towards the tail. Under the forewing there are yellow spots, and on the underside of the hindwing there are a row of orange-red spots, in front of blue caps, followed by black centered red spots towards the tail.

Range length: 7 to 9 cm.

Range wingspan: 11.5 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

  • Douglas, M. 1986. The Lives of Butterflies. Rexdale, Canada: The University of Michigan Press.
  • Scott, J. 1986. Butterflies of North America. Stanford, California: Stanford Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Adult black swallowtails range in length from seven to nine cm, and can reach a wingspan of 11.5 cm. Older larva vary from green to yellow and most often each segment is crossed by a black band. Pupae of this species can vary from green and yellow, to brown and white, to a black form.

The upper surface of an adult is black with two rows of yellow spots past the middle or median of the wing. In females these yellow spots are narrow and lighter, or nonexistent as is the case in North America where they can mimic Battus philenor (pipevine swallowtails). On the upper surface of the adults' hind wing, there are irridescent blue spots on males and an irridescent blue band on females. On the upperside of the hindwing there is a large red spot that has a black center towards the tail. Under the forewing there are yellow spots, and on the underside of the hindwing there are a row of orange-red spots, in front of blue caps, followed by black centered red spots towards the tail.

Range length: 7 to 9 cm.

Range wingspan: 11.5 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

  • Douglas, M. 1986. The Lives of Butterflies. Rexdale, Canada: The University of Michigan Press.
  • Scott, J. 1986. Butterflies of North America. Stanford, California: Stanford Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Black swallowtails tend to be found in open areas such as meadows, fields, parks, gardens, lowlands, marshes, and deserts.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: desert or dune ; savanna or grassland

Wetlands: marsh

  • Jackman, 1998. A Field Guide to Common Texas Insects. Houston, Texas: Gulf Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black swallowtails tend to be found in open areas such as meadows, fields, parks, gardens, lowlands, marshes, and deserts.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: desert or dune ; savanna or grassland

Wetlands: marsh

  • Jackman, 1998. A Field Guide to Common Texas Insects. Houston, Texas: Gulf Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Almost all open spaces, including gardens, farmland, meadows, banks of watercourses; in open woodlands mostly in spring. Breeding habitats include almost any open to sparsely wooded situation with foodplant umbellifers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The larvae of American swallowtails are attracted to the oils of plants such as dill, parsley, celery, carraway and carrots. These plants have adapted to insects herbivores by producing specific chemicals that repel the insects that try to eat them. American swallowtail larvae are resistant to these chemicals and make the caterpillar bad-tasting to Aves predators. Some plants from the Umbelliferae family make psoralens that reduce growth rate and fertility in American swallowtails. The larva are most often found at small flowers. Adults feed on flower nectar and mud.

Plant Foods: leaves; nectar; flowers

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The larvae of American swallowtails are attracted to Umbelliferae (or Apiaceae) oils. Umbelliferae plants include dill, parsley, celery, carraway and carrots. These plants have adapted to insects herbivores by producing specific chemicals known as psoralins that repel the insects that try to eat them. American swallowtail larvae are resistant to these psoralens because their intestine and body detoxify and eliminate the toxins quickly. Psoralens make the caterpillar bad-tasting to avian predators. Some plants from the Umbelliferae family make psoralens that reduce growth rate and fertility in American swallowtails. The larva are most often found at the small umbelliferae flowers. Adults feed on flower nectar and mud.

The larvae of American swallowtails are attracted to the oils of plants such as dill, parsley, celery, carraway and carrots. These plants have adapted to insects herbivores by producing specific chemicals that repel the insects that try to eat them. American swallowtail larvae are resistant to these chemicals and make the caterpillar bad-tasting to bird predators. Some plants from the Umbelliferae family make psoralens that reduce growth rate and fertility in American swallowtails. The larva are most often found at small flowers. Adults feed on flower nectar and mud.

Plant Foods: leaves; nectar; flowers

Primary Diet: herbivore (Folivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

These butterflies pollinate many plants. Their larvae eat many plant species. They also may provide food for many predator species.

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

These butterflies pollinate many plants. Their larvae eat many plant species. They also may provide food for many predator species.

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed mainly from nectar and mud. Males both perch and patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

To find a female black swallowtail, males alternately perch on the tops of hills and then patrol in flat areas. Males defend territories of about 70 square meters where they perch and patrol. Courtship lasts for about 45 seconds,and mating follows.

Females lay round, cream-colored eggs on the leaves of Umbelliferae plants. A female black swallowtail lays on average 200 - 440 eggs, 30 - 50 per day, starting at two days after emergence from the pupal stage.

Range eggs per season: 200 to 440.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Once eggs are fertilized and laid, there is no longer any parental care.

Parental Investment: pre-fertilization (Provisioning)

  • Jackman, 1998. A Field Guide to Common Texas Insects. Houston, Texas: Gulf Publishing.
  • Scott, J. 1986. Butterflies of North America. Stanford, California: Stanford Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

To find a female black swallowtail, males alternately perch on the tops of hills and then patrol in flat areas. Males defend territories of about 70 square meters where they perch and patrol. It has been found that about 67% of their day is spent perching, 25% patrolling, 6% feeding, and lastly 2% interacting with other butterflies. The location chosen by a male can and most often does change daily. Black swallowtails mate on hilltops. Courtship lasts for about 45 seconds. The male and female will flutter near each other momentarily, fly an approximate distance of 20 meters away from where courtship started and mate after landing. The coupling lasts from 30 to 45 minutes. After a successful mating, a female must survive, temporarily avoid, and reject other courting males. Many times, if the female survives, she will mate more than once to ensure fertilization of her eggs.

Females lay round, cream-colored eggs on the leaves of Umbelliferae plants. A female black swallowtail lays on average 200 - 440 eggs, 30 - 50 per day, starting at two days after emergence from the pupal stage.

Range eggs per season: 200 to 440.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Once eggs are fertilized and laid, there is no longer any parental care.

Parental Investment: pre-fertilization (Provisioning)

  • Jackman, 1998. A Field Guide to Common Texas Insects. Houston, Texas: Gulf Publishing.
  • Scott, J. 1986. Butterflies of North America. Stanford, California: Stanford Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilio polyxenes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTATTCAACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTATTTGAGCAAGTATATTAGGAACTTCACTTAGCTTATTAATTCGTACTGAATTAGGAACACCAGGTTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCATTAACTCTTTTAATTTCAAGAATAATCGTAGAAAATGGAGCTGGAACCGGTTGAACCGTTTACCCCCCTCTCTCTTCTAATATTGCCCATGGAAGAAGATCAGTAGATTTAGTTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGTATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCCGTTGGAATTACAGCTTTATTATTACTTCTTTCTCTACCAGTTTTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATCTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATCATTTCCCAAGAAAGAGGAAAAAAAGAAACATTTGGATGTTTAGGAATAATTTATGCAATAATAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTTGGAATAGATACTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Papilio polyxenes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

These butterflies are widespread and do not seem to be threatened.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These butterflies are widespread and do not seem to be threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Other Considerations: Benefits greatly from human clearing of land.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Biological Research Needs: None.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: None.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The caterpillar of this species is occasionally a pest in gardens and farms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

These butterflies have no positive economic effect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

The caterpillar of this species is occasionally a pest in gardens and farms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

These butterflies have no positive economic effect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Papilio polyxenes

The (eastern) black swallowtail (Papilio polyxenes), also called the American swallowtail or parsnip swallowtail,[1] is a butterfly found throughout much of North America. It is the state butterfly of Oklahoma. An extremely similar-appearing species, Papilio joanae occurs in the Ozark Mountains region, but it appears to be closely related to Papilio machaon, rather than P. polyxenes.

Contents

Description

Ventral view - female

The black swallowtail has a wingspan of 8 to 11 cm (3.1 to 4.3 in). The upper surface of the wings is mostly black. On the inner edge of the hindwing is a black spot centered in larger orange spot. A male of this species has a yellow band near edge of wings; a female has row of yellow spots. The hindwing of the female has an iridescent blue band.

In the southwestern United States, yellow forms predominate in the subspecies Papilio polyxenes coloro.

After mating, small, yellow eggs are laid, typically on plants from the carrot family, Apiaceae, including dill, fennel, Queen Anne's lace, parsley, and golden alexanders. They are also found eating rue and bishop's weed. First instar larvae grow to about 1.5 cm (0.59 in) long and resemble bird droppings. They are dark black with a white band in the middle and have spikes, with a light brown-orange ring at the base of each of the spikes in the dark region (spikes are white on the white band). Later instars grow to about 5 cm (2.0 in) and are green and black banded with yellow spots around every second black band. They have short, black spikes around some of the black bands, although these tend to disappear as the larva nears pupation.

Caterpillar and chrysalis

The black swallowtail caterpillar has an orange "forked gland", called the osmeterium. When in danger, the osmeterium, which looks like a snake's tongue, everts and releases a foul smell to repel predators.

Black swallowtail chrysalis

The pupae may be green or brown, but not depending on surroundings or the background on which they have pupated. The color of the chrysalis is determined by a local genetic balance that ensures the majority of pupae will blend in.[2]

Similar species

Etymology

Named for a figure in Greek mythology. Polyxena (pron.: /pəˈlɪksɨnə/; Greek: Πολυξένη) was the youngest daughter of King Priam of Troy.

Photogallery

References

  1. ^ Castner, J.L.. "Electronic Data Information Source". Institute of Food and Agricultural Sciences. University of Florida. http://edis.ifas.ufl.edu/IN032. Retrieved 2008-04-18.
  2. ^ Black Swallowtail, Butterflies of Canada

This article is adapted in part from this page at the USGS Northern Prairie Wildlife Research Center.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Former P. kahli is included here. Several subspecies are usually recognized.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!