Overview

Brief Summary

North American Ecology (US and Canada)

Resident in North America east of the Rockies (Scott 1986). Habitats are WOODS, MOUNTAINS AND SUBURBS. Host plants include many species, but mostly in one family, Umbelliferae. Hosts are usually herbaceous. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There are a variable number of flights based on latitude with the approximate flight time MAY15-JUN30 in the northern part of the range and JAN1-DEC31 in the southern part of their range (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) United States and southern Canada east of the Rockies; and Arizona, New Mexico, southern California, south into Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

The range of black swallowtails (also known as American swallowtails) extends from Southern Canada, through North America, and down to South America. Included in the South American range are the West Indies. In North America, black swallowtails are not commonly found west of the Rocky Mountains.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Ehrlich, P. 1961. How to Know Butterflies. Dubuque, Iowa: WM. C. Brown Company Publishers.
  • Neck, R. 1996. Butterflies of Texas. Houston, Texas: Gulf Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The range of black swallowtails (also known as American swallowtails) extends from Southern Canada, through North America, and down to South America. Included in the South American range are the West Indies. In North America, black swallowtails are not commonly found west of the Rocky Mountains.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Ehrlich, P. 1961. How to Know Butterflies. Dubuque, Iowa: WM. C. Brown Company Publishers.
  • Neck, R. 1996. Butterflies of Texas. Houston, Texas: Gulf Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult black swallowtails range in length from seven to nine cm, and can reach a wingspan of 11.5 cm. Older larva vary from green to yellow and most often each segment is crossed by a black band. Pupae of this species can vary from green and yellow, to brown and white, to a black form.

The upper surface of an adult is black with two rows of yellow spots. In females these yellow spots are narrow and lighter, or nonexistent. On the upper surface of the adults' hind wing, there are irridescent blue spots on males and an irridescent blue band on females. On the upperside of the hindwing there is a large red spot that has a black center towards the tail. Under the forewing there are yellow spots, and on the underside of the hindwing there are a row of orange-red spots, in front of blue caps, followed by black centered red spots towards the tail.

Range length: 7 to 9 cm.

Range wingspan: 11.5 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

  • Douglas, M. 1986. The Lives of Butterflies. Rexdale, Canada: The University of Michigan Press.
  • Scott, J. 1986. Butterflies of North America. Stanford, California: Stanford Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Adult black swallowtails range in length from seven to nine cm, and can reach a wingspan of 11.5 cm. Older larva vary from green to yellow and most often each segment is crossed by a black band. Pupae of this species can vary from green and yellow, to brown and white, to a black form.

The upper surface of an adult is black with two rows of yellow spots past the middle or median of the wing. In females these yellow spots are narrow and lighter, or nonexistent as is the case in North America where they can mimic Battus philenor (pipevine swallowtails). On the upper surface of the adults' hind wing, there are irridescent blue spots on males and an irridescent blue band on females. On the upperside of the hindwing there is a large red spot that has a black center towards the tail. Under the forewing there are yellow spots, and on the underside of the hindwing there are a row of orange-red spots, in front of blue caps, followed by black centered red spots towards the tail.

Range length: 7 to 9 cm.

Range wingspan: 11.5 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

  • Douglas, M. 1986. The Lives of Butterflies. Rexdale, Canada: The University of Michigan Press.
  • Scott, J. 1986. Butterflies of North America. Stanford, California: Stanford Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Almost all open spaces, including gardens, farmland, meadows, banks of watercourses; in open woodlands mostly in spring. Breeding habitats include almost any open to sparsely wooded situation with foodplant umbellifers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black swallowtails tend to be found in open areas such as meadows, fields, parks, gardens, lowlands, marshes, and deserts.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: desert or dune ; savanna or grassland

Wetlands: marsh

  • Jackman, 1998. A Field Guide to Common Texas Insects. Houston, Texas: Gulf Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black swallowtails tend to be found in open areas such as meadows, fields, parks, gardens, lowlands, marshes, and deserts.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: desert or dune ; savanna or grassland

Wetlands: marsh

  • Jackman, 1998. A Field Guide to Common Texas Insects. Houston, Texas: Gulf Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The larvae of American swallowtails are attracted to the oils of plants such as dill, parsley, celery, carraway and carrots. These plants have adapted to insects herbivores by producing specific chemicals that repel the insects that try to eat them. American swallowtail larvae are resistant to these chemicals and make the caterpillar bad-tasting to Aves predators. Some plants from the Umbelliferae family make psoralens that reduce growth rate and fertility in American swallowtails. The larva are most often found at small flowers. Adults feed on flower nectar and mud.

Plant Foods: leaves; nectar; flowers

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The larvae of American swallowtails are attracted to Umbelliferae (or Apiaceae) oils. Umbelliferae plants include dill, parsley, celery, carraway and carrots. These plants have adapted to insects herbivores by producing specific chemicals known as psoralins that repel the insects that try to eat them. American swallowtail larvae are resistant to these psoralens because their intestine and body detoxify and eliminate the toxins quickly. Psoralens make the caterpillar bad-tasting to avian predators. Some plants from the Umbelliferae family make psoralens that reduce growth rate and fertility in American swallowtails. The larva are most often found at the small umbelliferae flowers. Adults feed on flower nectar and mud.

The larvae of American swallowtails are attracted to the oils of plants such as dill, parsley, celery, carraway and carrots. These plants have adapted to insects herbivores by producing specific chemicals that repel the insects that try to eat them. American swallowtail larvae are resistant to these chemicals and make the caterpillar bad-tasting to bird predators. Some plants from the Umbelliferae family make psoralens that reduce growth rate and fertility in American swallowtails. The larva are most often found at small flowers. Adults feed on flower nectar and mud.

Plant Foods: leaves; nectar; flowers

Primary Diet: herbivore (Folivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

These butterflies pollinate many plants. Their larvae eat many plant species. They also may provide food for many predator species.

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

These butterflies pollinate many plants. Their larvae eat many plant species. They also may provide food for many predator species.

Ecosystem Impact: pollinates

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed mainly from nectar and mud. Males both perch and patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

To find a female black swallowtail, males alternately perch on the tops of hills and then patrol in flat areas. Males defend territories of about 70 square meters where they perch and patrol. Courtship lasts for about 45 seconds,and mating follows.

Females lay round, cream-colored eggs on the leaves of Umbelliferae plants. A female black swallowtail lays on average 200 - 440 eggs, 30 - 50 per day, starting at two days after emergence from the pupal stage.

Range eggs per season: 200 to 440.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Once eggs are fertilized and laid, there is no longer any parental care.

Parental Investment: pre-fertilization (Provisioning)

  • Jackman, 1998. A Field Guide to Common Texas Insects. Houston, Texas: Gulf Publishing.
  • Scott, J. 1986. Butterflies of North America. Stanford, California: Stanford Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

To find a female black swallowtail, males alternately perch on the tops of hills and then patrol in flat areas. Males defend territories of about 70 square meters where they perch and patrol. It has been found that about 67% of their day is spent perching, 25% patrolling, 6% feeding, and lastly 2% interacting with other butterflies. The location chosen by a male can and most often does change daily. Black swallowtails mate on hilltops. Courtship lasts for about 45 seconds. The male and female will flutter near each other momentarily, fly an approximate distance of 20 meters away from where courtship started and mate after landing. The coupling lasts from 30 to 45 minutes. After a successful mating, a female must survive, temporarily avoid, and reject other courting males. Many times, if the female survives, she will mate more than once to ensure fertilization of her eggs.

Females lay round, cream-colored eggs on the leaves of Umbelliferae plants. A female black swallowtail lays on average 200 - 440 eggs, 30 - 50 per day, starting at two days after emergence from the pupal stage.

Range eggs per season: 200 to 440.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Once eggs are fertilized and laid, there is no longer any parental care.

Parental Investment: pre-fertilization (Provisioning)

  • Jackman, 1998. A Field Guide to Common Texas Insects. Houston, Texas: Gulf Publishing.
  • Scott, J. 1986. Butterflies of North America. Stanford, California: Stanford Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilio polyxenes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTATTCAACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTATTTGAGCAAGTATATTAGGAACTTCACTTAGCTTATTAATTCGTACTGAATTAGGAACACCAGGTTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCATTAACTCTTTTAATTTCAAGAATAATCGTAGAAAATGGAGCTGGAACCGGTTGAACCGTTTACCCCCCTCTCTCTTCTAATATTGCCCATGGAAGAAGATCAGTAGATTTAGTTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGTATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCCGTTGGAATTACAGCTTTATTATTACTTCTTTCTCTACCAGTTTTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATCTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATCATTTCCCAAGAAAGAGGAAAAAAAGAAACATTTGGATGTTTAGGAATAATTTATGCAATAATAGCAATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTTGGAATAGATACTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Papilio polyxenes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Other Considerations: Benefits greatly from human clearing of land.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These butterflies are widespread and do not seem to be threatened.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These butterflies are widespread and do not seem to be threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: None.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: None.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The caterpillar of this species is occasionally a pest in gardens and farms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

These butterflies have no positive economic effect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

The caterpillar of this species is occasionally a pest in gardens and farms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

These butterflies have no positive economic effect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Papilio polyxenes

The (Eastern) Black Swallowtail (Papilio polyxenes), also called the American Swallowtail or Parsnip Swallowtail,[1] is a butterfly found throughout much of North America. It is the state butterfly of Oklahoma. An extremely similar-appearing species, Papilio joanae, occurs in the Ozark Mountains region, but it appears to be closely related to Papilio machaon, rather than P. polyxenes. The species is named after the figure in Greek mythology, Polyxena (pron.: /pəˈlɪksɨnə/; Greek: Πολυξένη), who was the youngest daughter of King Priam of Troy.

The Papilio polyxenes demonstrates polyandry and a lek mating system, showing no male parental care and display sites. Females are therefore able to choose males based on these sites and males are the only resource the females find at these sites.[2]

Taxonomy[edit]

P. polyxenes is part of the Papilionidae family of the swallowtail butterflies in the Papilionini tribe. The members of this tribe all have tails on the backwings, and therefore include species named Swallowtail.[3] P. polyxenes is part of the genus Papilio, which is the biggest group of the Papilionidae family. Members of this genus typically feed on plants of the family Lauraceae, Rutaceae, and Umbelliferae.[3]

Distribution[edit]

Papilio polyxenes are found from southern Canada through to South America. In North America they are more common east of the Rocky Mountains.[4][5] They are usually found in open areas like fields, parks, marshes or deserts, and they prefer tropical or temperate habitats.[6]

Morphology[edit]

Ventral view - female

Eggs and larvae[edit]

Eggs are pale yellow. Young larvae are mostly black and white with a saddle, and older larvae are green with black transverse bands containing yellow spots.[7]

Caterpillar and chrysalis[edit]

This caterpillar absorbs toxins from the host plants, and therefore tastes poorly to bird predators.[8] The Black Swallowtail caterpillar has an orange "forked gland", called the osmeterium. When in danger, the osmeterium, which looks like a snake's tongue, everts and releases a foul smell to repel predators.[8]

Chrysalis

The pupae may be green or brown, but not depending on surroundings or the background on which they have pupated. The color of the chrysalis is determined by a local genetic balance that ensures the majority of pupae will blend in.[9] Note that a section of the green pupae will turns a much darker green at the very end of the pupae stage. This color change occurs a few hours to a full day before hatching.[9]

Sexual dimorphism[edit]

The Black Swallowtail has a wingspan of 6.9–8.4 cm, and females are typically larger than males.[10] The upper wing surface is black with two rows of yellow spots – these spots are large and bright in males and smaller and lighter in females. Females have a prominent blue area between these two rows, while males have a much less prominent blue area. These differences give rise to effective Batesian mimicry seen in females.[10]

Both sexes show a red spot with a black bulls-eye on the inner hind margin of the hind wings and an isolated yellow spot on the front edge of the wings. The ventral side of wings of males and females are essentially identical: front wings have two rows of pale yellow spots, and hind wings have rows of bring orange spots separated by areas of powdery blue. The ventral side also acts as an effective mimic for both males and females for protection against predators.[10]

Mimicry[edit]

Female markings are similar to those of B. philenor, allowing females to engage in dorsal mimicry to reduce risk of predation by birds that preferably prey on the Black Swallowtail.[8] Females have evolved dorsal mimicry because they spend more time revealing their dorsal wing side during oviposition.[8] The ventral wing surface of the Black Swallowtail also mimics that of B. philenor, so both males and females are protected when their ventral wing surface is displayed.[8]

Intrasexual Selection[edit]

Male Black Swallowtails can sometimes mimic the female wing-back pattern, and therefore succeed in reduced predation as well.[11] However, males of the typical coloration are more successful in intrasexual competition for mating territories compared to the males who mimic the female wing pattern.[11] Females have no preference based on wing markings, and are equally likely to mate with a typical versus an alternative coloration.[11] Therefore, male-male intrasexual selection is of greater importance than female mate choice in maintaining the classic male wing-back coloration and pattern.[11]

Life cycle[edit]

Females lay single eggs on host plants, usually on the new foliage and occasionally on flowers. The eggs stage lasts four to nine days, the larval stage 10–30 days, and the pupal stage 18 days.[12] The duration of these stages may vary depending on temperature and the species of the host plants.[12]

Emergence[edit]

Winter is spent in the chrysalis stage, and adults will emerge in the spring to seek out host plants.[13] Adults will emerge in the mornings on a daily basis. First brood adults will fly from mid May until late June, second brood adults will fly from early July until late August, and occasionally a partial third brood will occur that will emerge later in the season.[14]

Life expectancy[edit]

Members of the Black Swallowtail are long-lived compared to other butterflies that inhabit temperate zones.[15] They encounter little predation and are quick and agile if they are disturbed. However, mortality from predators will occur during roosting and during unfavorable weather due to the associated increase in predation.[15] Adult butterflies are at the highest risk for predation when they are incapable of flight or are starved from poor weather.[15]

Food plants[edit]

Papilio polyxenes utilize a variety of herbs in the carrot family (Apiaceae), but will choose the food plants for their larvae based on visual and chemical variations.[16] Host plant odor is one of the cues involved in the selection of landing sites for oviposition.[17] The responses to these cues are innate, and feeding on a host plant as a larva does not increase the preference for that plant as an adult.[16]

Species of host plants include:[18]

Behavior[edit]

Thermoregulation[edit]

Core body, or thoracic temperatures of around 24 degrees Celsius are necessary for flight.[19] Therefore, the Black Swallowtail will regulate thoracic temperatures by behaviorally changing their abdomen position, wing position, orientation to the sun, perching duration, and perching height.[19] In lower temperatures, butterflies will raise their abdomens above flattened wings, and will perch relatively close to the ground.[19] In higher temperatures, butterflies will lower their abdomens in the shade of their wings.[19] Higher temperatures are also associated with shorter perch durations, greater flight durations, and higher perch heights.[19]

Territorial defense[edit]

Male butterflies secure territories to use in mate location and courtship.[14] These territories contain no significant concentration of nectar sources, larval host plants, or night settling sites. Once secured, a male will maintain exclusive use of a territory 95% of the time.[14] Males will aggressively chase other males who approach their territory, and then return to their territory.[14] Success in defending a territory depends on the number of competitors and his previous success, but the size of the male is not a contributing factor.[14] Males that emerge early in the brood are more likely to defend a female-preferred territory.[14] These males will have early access to available territories, and will choose the ones that are most preferred by females.[14] What makes a territory desirable by females remains unknown, and is only measured by the number of aggressive encounters between males and the overall mating frequency at these sites[14]

Male territories are generally of high relative elevation and topographic distinctness.[20] This feature serves as an advantage to the lek mating system described later, as males will be concentrated in predictable locations and will be easy to encounter by females.[14]

Aggression[edit]

In previous studies, nearly 80% of successful courtship flights were confined to a male’s territory. Because a preferred territory site is crucial in mating success, males are extremely aggressive in maintaining their territory.[14] Black swallowtails have a 4:1 male biased sex ratio, and a low female mating frequency which leads to intense male-male competition.[14]

Mating systems[edit]

Protandry[edit]

The Black Swallowtail is protandrous, meaning males emerge before females.[21] This emergence pattern is advantageous, because males that emerge earlier have a greater success in competing for superior territories, indicated by female preference.[21] These superior territories will most likely still be available for early emerging males, and securing one of these territories is highly predictive of mating success.[21] Furthermore, female fertility is directly correlated with their weight at emergence. This favors larger females, and explains why they emerge later to prolong the larval feeding period.[21] Male success is not dependent on size, so selection favors early emergence to get the best territories preferred by females, though this will most likely result in smaller males.[21] However, there is a drawback to this emergence system. For biological reasons, overall male mating frequency decreases as the mating season goes one. Therefore, early emerging males with early access to preferred territories will not be able to mate as often later in the mating season when female emergence is at its peak.[21]

Lek Mating[edit]

This type of territorial organization leads the Black Swallowtail to engage in a lek mating system.[22] These butterflies satisfy the four criteria for lekking behavior, as defined by J.W. Bradbury: (1) there is no male parental care, (2) males aggregate at specific sites for display, (3) the only resource females find at the lek are the males themselves, and (4) females can select their mates.[22]

The territory that has the most male-male encounters can be seen as being the most desirable to both males and females, and is also the territory that has the highest female visitation rate.[2] Hilltop leks give the advantage to females because they make it easy to locate mates, and competition for superiority creates an array of males who have already demonstrated their quality as a mate.[2]

Copulation[edit]

Males can only mate twice a day, but females will mate more than once to replace a sperm supply that has deteriorated with time.[2] P. polyxenes has a long mating period due to females tendency to mating multiply and having a broad emergence period.[2] This allows males to mate several times during their lifetime, despite only being able to copulate twice on the same day.[2] The Black Swallowtail engages in brief courtship flights and copulations will last around 45 minutes.[23]

Similar species[edit]

Photogallery[edit]

References[edit]

  1. ^ Castner, J.L. "Electronic Data Information Source". Institute of Food and Agricultural Sciences. University of Florida. Retrieved 2013-08-23. 
  2. ^ a b c d e f Lederhouse, Robert C. (1982). "Territorial Defense and Lek Behavior of the Black Swallowtail Butterfly, Papilio polyxenes". Behavioral Ecology and Sociobiology 10 (2): 109–118. doi:10.1007/bf00300170. 
  3. ^ a b “Genus Papilio.” http://en.butterflycorner.net/Genus-PAPILIO.366.0.html#c4148
  4. ^ Ehrlich, P. (1961). How to Know Butterflies. Dubuque, Iowa: WM. C. Brown Company Publishers.
  5. ^ Neck, R. (1996). Butterflies of Texas. Houston, Texas: Gulf Publishing Company.
  6. ^ Drees B.M. & Jackman, J.A. (1998). A Field Guide to Common Texas Insects. Houston, Texas: Gulf Publishing.
  7. ^ Timmerman S, Berenbaum MR. (1999). Uric acid deposition in larva integument of black swallowtails and speculation on its possible functions. Journal of the Lepidopterists' Society 53: 104-107.
  8. ^ a b c d e Lederhouse, Robert C.; Silvio G. Codella Jr. (1989). "Intersexual Comparison of Mimetic Protection in the Black Swallowtail Butterfly, Papilio polyxenes: Experiments with Captive Blue Jay Predators". Evolution 43 (2): 410–420. 
  9. ^ a b Black Swallowtail, Butterflies of Canada
  10. ^ a b c Lederhouse, Robert C.; Silvio G. Codella Jr. (1989). Intersexual Comparison of Mimetic Protection in the Black Swallowtail Butterfly, Papilio polyxenes: Experiments with Captive Blue Jay Predators. Evolution 43(2):410–420.
  11. ^ a b c d Lederhouse, Robert C.; J. Mark Scriber (1996). "Intrasexual Selection Constrains the Evolution of the Dorsal Color Pattern of Male Black Swallowtail Butterflies, Papilio polyxenes". Evolution 50 (2): 717–722. doi:10.2307/2410844. 
  12. ^ a b Minno MC, Butler JF, Hall DW. (2005). Florida Butterfly Caterpillars and their Host Plants. University Press of Florida. Gainesville, Florida. 341 pp.
  13. ^ "Black Swallowtail". Texas A&M Agrilife Extension. Retrieved 23 October 2013. 
  14. ^ a b c d e f g h i j k Lederhouse, Robert C. (1982). "Territorial Defense and Lek Behavior of the Black Swallowtail Butterfly, Papilio polyxenes". Behavioral Ecology and Sociobiology 10 (2): 109–118. doi:10.1007/bf00300170. 
  15. ^ a b c Lederhouse, Robert C. (1983). "Population structure, residency and weather related mortality in the black swallowtail butterfly, Papiliopolyxenes". Oecologia (Berlin) 59: 307–311. doi:10.1007/bf00378854. 
  16. ^ a b Heinz, Cheryl A.; Paul Feeny (2005). "Effects of contact chemistry and host plant experience in the oviposition behaviour of the eastern black swallowtail butterfly". Animal Behavior 69: 107–115. doi:10.1016/j.anbehav.2003.12.028. 
  17. ^ Baur, Robert; Paul Feeny; Erich Stadler (1993). "Oviposition Stimulants For the Black Swallowtail Butterfly: Identification of Electrophysiologically Active Compounds in Carrot Volatiles". Journal of Chemical Ecology 19 (5): 919–937. doi:10.1007/bf00992528. 
  18. ^ Hall, Donald W. (2011). Featured Creatures - Eastern Black Swallowtail. Entomology and Nematology Department, University of Florida. [1]
  19. ^ a b c d e Rawlins, John Edward (1980). "Thermoregulation by the Black Swallowtail Butterfly, Papilio Polyxenes (Lepidoptera: Papilionidae)". Ecology 61 (2): 345–357. doi:10.2307/1935193. 
  20. ^ Rutowski, Ronald L. (1984). "Sexual Selection and the Evolution of Butterfly Mating Behavior". Journal of Research on the Lepidoptera 23 (2): 124–142. 
  21. ^ a b c d e f Lederhouse, Robert C.; M.D. Finke, J.M Scriber (1982). "The Contributions of Larval Growth and Pupal Duration to Protandry in the Black Swallowtail Butterfly, Papiliopolyxenes". Oecologia (Berlin) 53: 296–300. doi:10.1007/bf00389003. 
  22. ^ a b Morales, M.B.; F. Jiguet; B. Arroyo (2001). "Exploded leks: what bustards can teach us". Ardeola 48 (1): 85–98. 
  23. ^ Lederhouse, Robert C. (1981). "The Effect of Female Mating Frequency on Egg Fertility in the Black Swallowtail". Journal of The Lepidopterists' Society 35: 266–277. 

This article is adapted in part from this page at the USGS Northern Prairie Wildlife Research Center.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Former P. kahli is included here. Several subspecies are usually recognized.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!