Overview

Comprehensive Description

Summary

"Papilio polytes, also called the Commom Mormon, is a common swallow-tail butterfly species widely distributed across Asia. This butterfly is known for the mimicry displayed by the numerous forms of its females which mimic inedible Red-bodied Swallowtails, such as the Common Rose and the Crimson Rose."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Upperside dull, somewhat brownish black. Underside: fore wing opaque dark brown, the internervular streaks broader, more prominent than on the upperside. Cilia black alternated with white. Antennae, head, thorax and abdomen black. The male has one morph only. It is a dark-coloured swallow-tailed butterfly. The upper forewing has a series of white spots decreasing in size towards the apex. The upper hindwing has a complete discal band of elongated white spots. It may or may not have marginal red crescents. The males are generally smaller in size than the females but not always. Both male and all forms of the female of P.polytes can vary considerably in size depending on climatic region. The female of the Common Mormon is polymorphic. Form cyrus, stichius, romulus & sakontala are found in India."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Wingspan 90-100 mm.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

"Papilio polytes romulus Cramer, 1775 – Indian Common Mormon"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

General Habitat

"Lightly wooded country, but is present everywhere and high up into the hills."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilio polytes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTATTTTACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTATTTGAGCAAGAATATTAGGAACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAACTCCAGGTTCTCTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCCCACGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTACTTCCCCCATCCCTAACCCTTTTAATTTCTAGAATAATTGTAGAAAATGGAGCTGGAACTGGTTGAACTGTTTACCCCCCTCTTTCATCTAATATTGCCCATGGAAGAAGATCTGTTGATTTAGTTATTTTTTCTCTTCATTTAGCTGGTATTTCATCAATTTTAGGTGCAATTAACTTTATTACAACAATTATTAATATACGAATTAATAGAATATCTTTTGATCAAATACCATTATTTGTATGAGCTGTAGGAATCACTGCCTTATTACTACTCCTTTCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTTAAATACATCCTTTTTTGATCCTGCAGGAGGAGGTGACCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGTATAATCTCTCATATTATTTCTCAAGAAAGAGGAAAAAAGGAAACATTTGGTTGTTTAGGAATAATTTATGCCATAATAGCAATTGGATTACTTGGATTTATTGTATGAGCTCATCATATATTTACTATTGGTATAGATACTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Papilio polytes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Common
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Papilio polytes

The common Mormon (Papilio polytes) is a common species of swallowtail butterfly widely distributed across Asia.

This butterfly is known for the mimicry displayed by the numerous forms of its females which mimic inedible red-bodied swallowtails, such as the common rose and the crimson rose.

Names[edit]

The common name is an allusion to the polygamy formerly practiced by members of the Mormon sect according to Harish Gaonkar, of the Natural History Museum in London:[1]

... the origins of giving common English names to organisms, particularly butterflies for tropical species started in India around the mid 19th century ... The naming of Mormons evolved slowly. I think the first to get such a name was the common Mormon (Papilio polytes), because it had three different females, a fact that could only have been observed in the field, and this they did in India. The name obviously reflected the ... Mormon sect in America, which as we know, practiced polygamy.

The scientific name is constructed from the Latin word for butterfly, papilio, and the Greek word for many, poly.[2]

Range[edit]

Pakistan, India, Bangladesh, Nepal, Sri Lanka, Myanmar, Thailand, southern and western China (including Hainan (Guangdong province), Taiwan, Hong Kong, Japan (Ryukyu Islands), Vietnam, Laos, Kampuchea, Andamans, Nicobars, Eastern and Peninsular Malaysia, Brunei, Indonesia (except Moluccas and Irian Jaya), Philippines, and Northern Marianas (Saipan).

Status[edit]

Very common. Not threatened.[3]

Description[edit]

Comparison between similar-looking species - A. pandiyana, A. aristolochiae, P. polytes and P. helenus

Jet black butterfly with row of white spots along the middle part of hindwing. 90–100 mm.

Male[edit]

The male has one morph only. It is a dark-coloured swallow-tailed butterfly. The upper forewing has a series of white spots decreasing in size towards the apex. The upper hindwing has a complete discal band of elongated white spots. It may or may not have marginal red crescents. The males are generally smaller in size than the females but not always. Both male and all forms of the female of P. polytes can vary considerably in size depending on climatic region.

Female[edit]

The female of the common Mormon is polymorphic. In South Asia, it has three forms or morphs. These are as follows:
Form cyrus
This form is similar to the male, differing in that it always has strongly marked red crescents. It is the least common of the three forms. It is normally abundant where the common rose or crimson rose do not occur, such as in Himachal Pradesh around Shimla; although a few specimens of form romulus have also been caught alongside.
Form stichius
This female form of the common Mormon mimics the common rose very closely. This is the commonest form wherever the common rose flies.
Form romulus
This female form mimics the crimson rose and is common over its range. It is not such a close mimic as the previous form being duller than its model. It is easy to differentiate the mimics from models by the colour of their body—the models are red-bodied and the mimics are black-bodied.

Gynandromorphs[edit]

This species has considerable genetic variability and is known to produce gynandromorphs, genetic aberrations which are part male and part female.

Taxonomy[edit]

Papilio polytes is the nominal member of the polytes species-group. The clade members are:

The subspecies of Papilio polytes listed alphabetically are:[4]

  • P. p. alcindor Oberthür, 1879 – Buton, Salayer & Sulawesi
  • P. p. alphenor Cramer, [1776] – Philippines
  • P. p. javanus Felder, 1862 – Bali, Bangka, Biliton, Java & southern Sumatra
  • P. p. ledebouria Eschscholtz, 1821 – Philippines
  • P. p. liujidongi Huang, 2003 – Yunnan
  • P. p. mandane Rothschild, 1895 – western China
  • P. p. messius Fruhstorfer, 1909 – Lombok
  • P. p. nicanor C. & R. Felder, 1865 – Bachan, Halmahera, Morotai, Obi & Ternate
  • P. p. nikobarus C. Felder, 1862 – Nicobar Islands
  • P. p. pasikrates Fruhstorfer, 1908 – Philippines (Batanes) & Taiwan
  • P. p. perversus Rothschild, 1895 – Sangir & Talaud
  • P. p. polycritos Fruhstorfer, 1902 – Banggai, Sula Is.
  • P. p. polytes Linnaeus, 1758 – Indo-China, China & Taiwan
  • P. p. romulus Cramer, [1775] – India, Burma & Ceylon
  • P. p. sotira Jordan, 1909 – Sumbawa
  • P. p. steffi (Page & Treadaway, 2003) – Bongao, Sibutu & Tawitawi in the Philippines
  • P. p. stichioides Evans, 1927 – South Andamans
  • P. p. theseus Cramer, [1777] – Sumatra & Borneo
  • P. p. timorensis C. & R. Felder, 1864 – Babar Islands, Wetar, Leti, & possibly Timor
  • P. p. tucanus Jordan, 1909 – Tukangbesi Islands
  • P. p. vigellius Fruhstorfer, 1909 – Bawean

Mimicry[edit]

Crimson rose, compare with form romulus

In India, this butterfly is considered as the classic example of Batesian mimicry in which edible species resemble unpalatable butterflies in order to escape being eaten by predators.

The populations of the mimicking morphs of the common Mormon are much smaller than that of their models - the common or crimson rose. This is in order to allow first time predators a much greater chance of preying upon the unpalatable model in the first instance and thus learning of their inedibility.

Larger populations of mimics could result in the edible common Mormon mimics being sampled the first time by predators. If this should happen, the predator may not realise that butterflies of that colour and pattern are protected by the poisons they ingest; thus dramatically reducing the effectiveness of this scheme of protection.

In Sulawesi, although the common rose is abundant, the common Mormon female morph which is found there, mimics a completely different butterfly, Atrophaneura polyphontes.

Habitat[edit]

The common Mormon prefers lightly wooded country, but is present everywhere and high up into the hills. It is a regular visitor to gardens, being especially abundant in orchards of its foodplants—oranges and limes. It is most common in the monsoon and post-monsoon months.

Habits[edit]

Female form romulus seen laying an egg on Murraya paniculata

The common Mormon is fond of visiting flowers and its long proboscis permits it to feed from flowers having long corollar tubes. It is particularly fond of Lantana, Jatropha, Ixora, and Mussaenda in city gardens. In the forests, the common Mormon remains low keeping within ten feet off the floor and its prefer to visit Asystasia, Peristrophe, and Jasminum for nectar.

The male common Mormon is a very common visitor to gardens where he will be seen hovering over flowers when the sun is shining. It is a restless insect, zig-zagging fast and straight close to the ground, settling down only when it halts to feed.

The mimic female Mormons, stichius and romulus are very convincing mimics due to their habits, especially the flight patterns, being very similar to those of the rose models. However, lacking the protection of inedibility, they tend to be more easily disturbed than the roses and fly off erratically .

Only the males take part in mud puddling, usually in cool shaded spots rather than in open areas. They have been known to collect on saline soils to extract minerals.[5]

Both sexes bask in the sun on shrubs close to the ground. They hold their wings flat against the substratum. The forewing is lowered to cover part of the hindwing and is a typical stance of the common Mormon.

Common Mormons spend the night settled on vegetation with their wings held open, usually quite close to the ground.

Lifecycle[edit]

The females perch on an exposed branch with wings open or closed. They are courted by the males who approach from behind and slowly and elegantly settle into position.

Eggs[edit]

The eggs are laid singly on top of the leaves. They are round and yellow to light-orange in colour.

Caterpillar[edit]

The first few instars of the caterpillar closely resemble those of the lime butterfly.

The later instars become dark green in colour. There is a transverse black band with an eye-spot on each side on the 4th and 5th segments. This band, being darker and brighter than that of the Lime Butterfly caterpillar, is the key distinction between the two.

The common Mormon caterpillar also has a black and white oblique band on the 8th and 9th segments, making it resemble that of the blue Mormon. The deep red osmeterium and yellowish-brown head help distinguish it from the blue Mormon caterpillar which has a greenish head.

Common Mormon caterpillars are heavily parasitised by chalcid wasps, with over a hundred tiny wasps eventually emerging from each Mormon pupa.

Pupa[edit]

The pupa is located on underside of leafs and twigs. The pupa is light green and unmarked. It has two projections to the front on its head and also one on its thorax. It closely resembles the Lime Butterfly caterpillar but can be distinguished by:

  • the projections on the head which have a deeper indentation between them.
  • the abdomen which protrudes to a small point on each side.

Foodplants[edit]

The larvae breed on various species of Family Rutaceae including:

See also[edit]

References[edit]

  1. ^ Asian Mormon Butterflies Accessed November 2006
  2. ^ Papilio polytes PDF[dead link]
  3. ^ Collins, N.M. & Morris, M.G. (1985). Threatened Swallowtail Butterflies of the World. IUCN. ISBN 2-88032-603-6
  4. ^ Savela, Marrku (16 Feb 2008). "Papilio". Lepidoptera and some other life forms. nic.funet.fi. Retrieved 21 June 2013. 
  5. ^ Pola, M., García-París, M. (2005). Marine puddling in Papilio polytes (Lepidoptera Papilionidae). Florida Entomologist 88: 211-213
  6. ^ Kunte, K. (2006). Additions to known larval host plants of Indian butterflies. J. Bombay Nat. Hist. Soc. 103(1):119-120

Further reading[edit]

  • Evans, W.H. (1932). The Identification of Indian Butterflies. (2nd Ed), Bombay Natural History Society, Mumbai, India
  • Gay, Thomas; Kehimkar, Isaac & Punetha, J.C. (1992). Common Butterflies of India. WWF-India and Oxford University Press, Mumbai, India.
  • Haribal, Meena (1994). Butterflies of Sikkim Himalaya and their Natural History.
  • Kunte, Krushnamegh (2005). Butterflies of Peninsular India. Universities Press.
  • Wynter-Blyth, M.A. (1957). Butterflies of the Indian Region. Bombay Natural History Society, Mumbai, India.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Papilio sakontala

Papilio sakontala is a species of swallowtail butterfly from the genus Papilio that is found in India.[1]

Taxonomy[edit]

The taxonomic rank of Papilio sakontala is uncertain. It is a member of the fuscus species-group. The members of this clade are

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!