Overview

Brief Summary

The Great Mormon butterfly, Papilio memnon, is a large swallowtail butterfly (family Papilionidae) with wingspan up to 135mm, native to and common throughout Southeast Asia. Larvae feed on citrus species, particularly pomelo (citrus grandis) and common lime (citrus aurantifolia) which are broadly cultivated across Asia. Adults lay single eggs on the underside of leaves, which hatch in three days. For the first four instars, caterpillars resemble bird droppings. Pupation occurs after about 2.5 weeks. Adults inhabit forest clearings and disturbed areas, eating nectar from a wide variety of flowering species.

Alfred Russel Wallace first described the remarkable polymorphic nature of P. memnon, which exists as 13 subspecies and in addition, females show a large diversity of morphological and coloration forms, many of which are mimetic of other unpalatable papilionid species (Batesian mimicry). Female morphological variations include: presence or absence of tails, hindwing pattern, forewing pattern, color of the basal triangle on the forewing, and abdomen color. Extensive study of this species has contributed insight into the genetic determination of mimicry. These studies give classic evidence for existence of a “supergene” complex, which slowly built up over the course of evolution allowing butterfly species to mimic their models very accurately. This complex includes multiple linked genes that control the morphological variations listed above via genetic crossover, rather than these traits diversifying individually by point mutations, or other genetic mechanism.

Papilio memnon was featured in the Smithsonian’s spring quiz in 2012. An unusual gynandromorph (half male, half female) attracted a lot of attention when it eclosed at the "Sensational Butterflies" exhibition at the Natural History Museum in London (Sample 2011)

(Clarke, Sheppard and Thornton 1968; Clarke and Sheppard 1971; Jones et al. 2011; Mallet 2001; Tan 2009; Wikipedia 2011)

Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Summary

"Papilio memnon, commonly called the Great Mormon, is a large handsome Papilionid butterfly species found in many parts of Asia."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"It has four male and many female forms, the females being highly polymorphic and many of them being mimics of unpalatable butterflies. Form agenor: Male. Tailless, above deep blue to black. It may or may not have red streak on the forewing at the base of the cell. Female. Tailless. Upperside forewing ground colour sepia, streaked with greyish white. The basal third part of the cell is red and is touched outwardly with white. Upper hindwing is blue-black. It has 5 to 7 yellow or white discal patches."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Wingspan 120-150 mm.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

"Papilio memnon agenor Linnaeus, 1758 – Continental Great Mormon"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

General Habitat

"Up to 2,100 m (6,900 ft) in the Himalayas, but is most common at low elevations."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilio memnon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTATTTTACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTATTTGAGCAAGAATATTAGGAACCTCATTAAGCTTATTAATTCGAACAGAACTAGGAATTCCAGGTTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGGGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTCTGATTACTCCCCCCATCCTTAACTCTTTTAATTTCTAGTATAATTGTAGAAAATGGAGCTGGAACTGGTTGAACAGTCTATCCCCCTCTTTCATCTAATATTGCCCATGGAAGAAGATCTGTTGACTTAGTTATTTTCTCCCTCCATCTAGCAGGAATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATAAAAATTAATAATATATCATTTGATCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACTGCTTTATTATTACTTCTTTCCCTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGTAATTTAAATACATCTTTTTTTGACCCCGCAGGAGGAGGTGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTTTACCGGGATTTGGAATAATTTCCCATATTATTTCCCAAGAAAGAGGAAAAAAAGAAACATTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGACTTCTTGGATTCATTGTTTGAGCTCACCATATATTTACTATTGGTATAGATACAGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Papilio memnon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Least Concern
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Papilio memnon

The Great Mormon (Papilio memnon) is a large butterfly that belongs to the swallowtail family and is found in southern Asia. It is widely distributed and has thirteen subspecies. The female is polymorphic and with mimetic forms.

Range[edit]

North-eastern India (including Sikkim, Assam and Nagaland), Nepal, Bangladesh, Bhutan(?), Myanmar, Nicobar Islands, Andaman Islands (stragglers only), western, southern and eastern China (including Hainan), Taiwan and southern Japan, Ryukyu Islands, Thailand, Laos, Vietnam, Kampuchea, Malaysia, and Indonesia (Sumatra, Mentawai Islands, Nias, Batu, Simeulue, Bangka, Java, Kalimantan, and the Lesser Sunda Islands).

Status[edit]

Common and not threatened. The cultivation of Citrus plants all over Southern Asia has ensured this.

Description & polymorphy[edit]

The butterfly is large with 120 to 150 mm span. It has four male and many female forms, the females being highly polymorphic and many of them being mimics of unpalatable butterflies. This species has been studied extensively for understanding the genetic basis for polymorphy and Batesian mimicry. As many as twenty-six female forms are reported.[1][2][3]

Typical form agenor[edit]

Great Mormon, female
P. m. agenor, male
  • Male. Tailless, above deep blue to black. It may or may not have red streak on the forewing at the base of the cell.
  • Female. Tailless. Upperside forewing ground colour sepia, streaked with greyish white. The basal third part of the cell is red and is touched outwardly with white. Upper hindwing is blue-black. It has 5 to 7 yellow or white discal patches.

Female form butlerianus[edit]

  • Tailless. Resembles the typical male. Both Wings are dark sepia. The forewing has a white area on the inner margin. The hindwing is scaled with blue.

Female form alcanor[edit]

  • Tailed. The sides of the abdomen are yellow.
  • Upperside forewing greyish brown with veins and streaks between them black. The cell is red at the base. There is a velvety black patch at the bases of veins 1 and 2 of the upperside forewing.
  • Upperside hindwing is black with part of the cell white. There are white streaks around it. The tornus is red with a large black spot. There is a row of red terminal spots between the vein.

Male & female form polymnestoroides[edit]

  • Tailless.
  • Male. Upperside hindwing and forewing have short blue discal stripes.
  • Female. The upperside forewing is sepia with pale grey streaks amongst the veins. The base of the cell is red. The upperside hindwing is velvety brown with a blue discal area and has black spots, as in the case of the Blue Mormon (P. polymnestor), which it mimics.

Habitat[edit]

Flies up to 2,100 m (6,900 ft) in the Himalayas, but is most common at low elevations.

Behaviour[edit]

Underside

This butterfly is found in forest clearings. It is very common and is also seen amongst human habitation. It is fond of visiting flowers of Poinsettia, Jasminum, Lantana, Canna, and Salvia. It usually flies 2 to 4 metres above the ground. The butterfly is known to mud-puddle. The males are much commoner than females. The female forms butlerianus and alcanor are especially uncommon.

Mating pair seen at Angkor Butterfly Center

Life cycle[edit]

The larva resembles that of the Common Mormon, being green with whitish markings. It is heavily parasitised.

Foodplants[edit]

See also[edit]

References[edit]

  1. ^ C. A. Clarke, P. M. Sheppard & I. W. B. Thornton (1968). "The genetics of the mimetic butterfly Papilio memnon L.". Philosophical Transactions of the Royal Society B: Biological Sciences 254 (791): 37–89. Bibcode:1968RSPTB.254...37C. doi:10.1098/rstb.1968.0013. JSTOR 2416804. 
  2. ^ C. A. Clarke & P. M. Sheppard (1971). "Further studies on the genetics of the mimetic butterfly Papilio memnon L.". Philosophical Transactions of the Royal Society B: Biological Sciences 263 (847): 35–70. Bibcode:1971RSPTB.263...35C. doi:10.1098/rstb.1971.0109. JSTOR 2417186. 
  3. ^ C. A. Clarke & P. M. Sheppard (1973). "The genetics of four new forms of the mimetic butterfly Papilio memnon L.". Proceedings of the Royal Society B: Biological Sciences 184 (1074): 1–14. Bibcode:1973RSPSB.184....1C. doi:10.1098/rspb.1973.0027. JSTOR 76137. 
  • Collins, N. M. & Morris, M. G. (1985) Threatened Swallowtail Butterflies of the World. IUCN. ISBN 2-88032-603-6
  • Evans, W. H. (1932) The Identification of Indian Butterflies. (2nd ed), Bombay Natural History Society, Mumbai, India
  • Haribal, Meena (1994) Butterflies of Sikkim Himalaya and their Natural History.
  • Wynter-Blyth, M. A. (1957) Butterflies of the Indian Region, Bombay Natural History Society, Mumbai, India.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!