Overview

Brief Summary

North American Ecology (US and Canada)

Stray in southwestern North America (Scott 1986). Habitats are OPEN SUBTROPICAL AREAS. Host plants are largely restricted to a few species mostly in one family, Rutaceae. Hosts are herb or tree. Individuals can stray into Texas and surrounding areas, usually JUL-SEPT (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General comments

This information is based an ongoing project dedicated to the inventory and dissemination of information on lepidopteran larvae, their host plants, and their parasitoids in a Costa Rican tropical wet forest and an Ecuadorian montane cloud forest.


N=90 rearings as of 2012, 40 eclosed, 46 died and 4 were parasitized.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Collected in Heredia Province, Costa Rica.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Foodplant Associations

Piperaceae: Piper auritum, Piper colonense, Piper hispidum, Piper multiplinervium, Piper holdrigeanum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Parasitoid Associations

Tachinidae: N=4

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilio thoas nealces

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATACTTTATTTTTGGAATTTGAGCAAGAATACTAGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTAGGTACCCCCGGCTCATTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAATTCCTTTGATATTAGGAGCCCCCGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGACTTCTGCCCCCCTCCTTAACTCTTCTAATTTCAAGAATAATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTTTACCCCCCTCTTTCCTCTAATATTGCACATGGAAGAAGATCAGTAGACTTAGTTATTTTTTCTTTACATTTAGCGGGAATTTCTTCAATTCTTGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAGAATATCCTTCGATCAAATACCTTTATTTGTCTGAGCTGTAGGAATTACAGCTTTACTATTACTTTTATCTTTACCCGTTTTAGCCGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCTGCTGGAGGGGGAGATCCAATCTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Papilio thoas nealces

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Papilio thoas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CGAAAATGATTTTATTCAACAAATCATAAAGATATTGGGACATTATACTTTATTTTTGGAATTTGAGCAAGAATACTAGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTAGGTACCCCCGGCTCATTAATTGGTGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAATTCCTTTAATATTAGGCGCCCCCGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGACTTTTACCCCCTTCTCTAACTCTCCTAATTTCAAGAATAATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTTTACCCCCCTCTTTCTTCTAATATTGCACATGGAAGAAGGTCAGTAGACTTAGTTATTTTTTCTTTACATTTAGCAGGAATTTCTTCAATTCTTGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAGAATATCCTTCGATCAAATACCTTTATTTGTCTGAGCTGTAGGAATTACAGCTTTACTATTACTTTTATCTTTACCCGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATCTTATACCAACATTTATTTTGATTTTTTGGCCATCCAGAAGTTTATATTTTAATTTTACCCGGATTTGGAATAATTTCTCACATTATTTCTCAAGAAAGAGGAAAAAAAGAAACATTTGGTTGTTTAGGAATAATTTATGCAATAATAGCAATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAGATACTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Papilio thoas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Papilio thoas

The King Swallowtail or Thoas Swallowtail (Papilio thoas) is a butterfly of the family Papilionidae. It is found in the southernmost United States, Mexico, Central America and South America (as far south as Argentina and Uruguay). The species is easily confused with the Giant Swallowtail, which it closely resembles in both larval and adult stages. Thoas caterpillars, however, feed on plants of the black pepper family, Piperaceae, while giant swallowtail larvae eat the leaves of citrus plants Rutaceae.

Adult Thoas swallowtails fly year round in the tropics, feeding on nectar of a variety of flowers, including Lantana, Stachytarpheta, and Bougainvillea among other species. The wingspan is 100–130 mm.

Subspecies[edit]

Listed alphabetically.[1]

  • P. t. autocles Rothschild & Jordan, 1906
  • P. t. brasiliensis Rothschild & Jordan, 1906
  • P. t. cinyras Ménétriés, 1857
  • P. t. nealces Rothschild & Jordan, 1906
  • P. t. oviedo Gundlach, 1866
  • P. t. thoantiades Burmeister, 1878
  • P. t. thoas Linnaeus, 1771

References[edit]

  1. ^ Papilio, funet.fi
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!