Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilio astyalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGAAAATGACTTTATTCGACAAATCATAAAGATATTGGAACATTATACTTTATTTTTGGTATTTGAGCAAGAATATTAGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTAGGAACCCCAGGTTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGAGCTCCTGACATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTTTGCCCCCTTCGCTAACTCTTTTAATTTCAAGAATAATTGTAGAAAATGGAGCCGGAACTGGATGAACTGTTTATCCTCCTCTTTCTTCTAACATTGCCCATGGAAGAAGTTCAGTAGATTTAGTTATTTTTTCTCTTCATTTAGCAGGTATTTCCTCAATTTTAGGCGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAGAATATCCTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTACTTCTATCTTTACCCGTTTTAGCTGGAGCTATTACTATATTACTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCCGCAGGAGGAGGAGATCCTATTCTATACCAACATTTATTTTGATTCTTTGGACATCCTGAAGTTTATATTTTAATTTTACCGGGATTTGGAATAATTTCCCATATTATTTCCCAAGAAAGAGGAAAAAAAGAAACATTTGGTTGTTTAGGAATAATTTATGCTATGTTAGCAATTGGTCTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAGATACAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Papilio astyalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Papilio astyalus

The Broad-banded Swallowtail or Astyalus Swallowtail (Papilio astyalus) is a butterfly of the Papilionidae family. It is found from Mexico south to Argentina. It is occasionally reported from southern Texas and rare strays can be found up to southern Arizona and northern Texas.

The wingspan is 117–120 mm. Adults are on wing from April to October. There are probably two generations per year.

The larvae feed on the leaves of Citrus trees. Adults feed on the nectar of various flowers, including Lantana species.

Subspecies[edit]

  • Papilio astyalus astyalus (Brazil (Rio Grande do Sul, São Paulo, Minas Gerais, Parana), Argentina, Paraguay)
  • Papilio astyalus pallas Gray, [1853] (Texas, Mexico, Costa Rica)
  • Papilio astyalus bajaensis Brown & Faulkner, 1992 (Mexico (Baja California Sur))
  • Papilio astyalus hippomedon (C. & R. Felder, 1859) (Colombia, Venezuela)
  • Papilio astyalus phanias Rothschild & Jordan, 1906 (Ecuador, Peru, Bolivia, Goias)
  • Papilio astyalus anchicayaensis Constantino, Le Crom & Salazar, 2002 (Colombia)

Ecozone[edit]

Neotropical ecozone.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!