Ecology

Habitat

Depth range based on 6 specimens in 34 taxa.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.5 - 1737.36
  Temperature range (°C): 2.780 - 2.780
  Nitrate (umol/L): 26.803 - 26.803
  Salinity (PPS): 34.807 - 34.807
  Oxygen (ml/l): 4.761 - 4.761
  Phosphate (umol/l): 1.886 - 1.886
  Silicate (umol/l): 51.369 - 51.369

Graphical representation

Depth range (m): 0.5 - 1737.36
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Barbus (Barbus sp.) is prey of:
Aves
Crocodilia
Homo sapiens

Based on studies in:
Ethiopia, Lake Abaya (Lake or pond)

This list may not be complete but is based on published studies.
  • D. Riedel, Der Margheritensee (Sudabessinien) - Zugleich ein Beitrag zur Kenntnis der Abessinischen Graben-Seen, Arch. Hydrobiol. 58(4):435-466, from p. 457 (1962).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Barbus (Barbus sp.) preys on:
Insecta
zoobenthos

Based on studies in:
Malawi (River)
Africa, Crocodile Creek, Lake Nyasa (Lake or pond)
Ethiopia, Lake Abaya (Lake or pond)

This list may not be complete but is based on published studies.
  • G. Fryer, The trophic interrelationships and ecology of some littoral communities of Lake Nyasa, Proc. London Zool. Soc. 132:153-229, from p. 219 (1959).
  • G. Fryer, 1957. The trophic interrelationships and ecology of some littoral communities of Lake Nyasa with special reference to the fishes, and a discussion of the evolution of a group of rock-frequenting Cichlidae. Proc. Zool. Soc. London 132:153-281, f
  • D. Riedel, Der Margheritensee (Sudabessinien) - Zugleich ein Beitrag zur Kenntnis der Abessinischen Graben-Seen, Arch. Hydrobiol. 58(4):435-466, from p. 457 (1962).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:1,320Public Records:218
Specimens with Sequences:1,021Public Species:35
Specimens with Barcodes:1,017Public BINs:37
Species:107         
Species With Barcodes:91         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Barbus cf. kerstenii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Barbus cf. mattozi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Barbus cf. thamalakanensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Barbus cf. macrotaenia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Barbus cf. kessleri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Barbus cf. chiumbeensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCCCTAAGCCTCCTTATTCGGGCTGAACTAAGCCAACCCGGGTCGCTTTTAGGTGACGACCAAATCTATAACGTTATCGTTACTGCCCACGCTTTCGTAATAATTTTCTTTATAGTTATACCAATCCTTATCGGAGGGTTTGGAAACTGATTAGTCCCCCTAATAATTGGGGCCCCAGACATAGCATTTCCCCGAATAAATAACATAAGCTTCTGATTACTACCCCCCTCATTCCTCCTACTTTTAGCCTCTTCCGGGGTAGAAGCAGGAGCAGGAACAGGTTGAACAGTATACCCACCTCTTGCAGGAAATTTAGCCCACGCAGGGGCATCAGTAGACCTAACAATTTTCTCACTTCACCTAGCAGGTATTTCATCAATCCTTGGAGCAATTAATTTTATTACCACAACTATTAATATGAAACCCCCAGCTATTTCCCAATATCAAACACCACTATTCGTTTGATCAGTGCTTGTAACTGCCGTATTACTACTTCTTTCACTACCTGTATTAGCTGCCGGGATTACAATACTTCTAACAGATCGAAACCTAAACACCACGTTCTTTGACCCCGCAGGAGGAGGAGACCCAATTCTCTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Barbus cf. chiumbeensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Barbus cf. aboinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCCTTAAGCCTTCTTATCCGGGCTGAACTAAGTCAACCCGGATCGCTTCTAGGTGATGACCAAATTTATAATGTTATCGTTACTGCTCACGCCTTCGTAATAATTTTCTTTATAGTAATACCCATCCTTATTGGAGGATTTGGAAACTGGCTTGTACCACTAATAATTGGGGCCCCAGACATGGCGTTCCCACGTATAAATAACATAAGTTTCTGACTTCTACCCCCATCATTTCTTCTTCTGCTGGCCTCTTCCGGCGTTGAAGCTGGAGCCGGAACAGGATGAACAGTTTACCCGCCTCTTGCAGGCAACCTAGCCCACGCAGGAGCATCAGTAGATCTGACAATTTTTTCACTCCACTTAGCAGGTGTCTCATCAATTCTAGGGGCAATTAACTTTATTACTACAACAATTAACATAAAACCCCCAGCTATTTCCCAGTATCAAACACCTTTATTTGTTTGATCCGTGCTTGTAACCGCTGTACTACTACTCTTATCATTGCCAGTTTTAGCCGCTGGAATTACAATGCTTCTAACAGATCGAAACCTAAACACCACATTCTTCGACCCAGCAGGTGGAGGAGACCCAATTCTATATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Barbus cf. aboinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Barbus cf. apleurogramma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Barbus cf. martorelli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCCTTAAGCCTTCTCATTCGGGCTGAACTAAGTCAACCCGGATCGCTTTTAGGTGACGACCAAATTTATAATGTTATCGTTACTGCCCACGCTTTCGTGATAATTTTCTTTATAGTTATACCAATCCTTATTGGGGGATTTGGGAACTGACTGGTACCTTTAATAATTGGGGCCCCAGACATAGCATTCCCCCGAATGAATAACATAAGCTTCTGATTACTGCCCCCTTCATTCCTTCTACTTTTAGCTTCTTCCGGAGTAGAAGCAGGGGCAGGAACAGGTTGAACAGTATATCCACCTCTTGCAGGAAATTTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTTTCACTTCACCTAGCAGGTGTTTCATCAATTCTTGGAGCAATCAATTTTATTACCACAACTATTAATATGAAACCTCCAGCCATTTCCCAGTATCAAACACCACTATTCGTTTGATCTGTGCTTGTAACTGCCGTACTTCTACTTCTTTCATTACCTGTATTAGCTGCCGGAATTACAATACTTTTAACAGATCGAAACCTAAATACCACTTTCTTTGACCCCGCAGGAGGAGGAGACCCAATTCTTTATCAACATCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Barbus cf. martorelli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Barbus sp. odessa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Barbus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Barbus sp. 'Pangani'

Barbus sp. 'Pangani' is an undescribed but distinct ray-finned fish species in the family Cyprinidae. Apparently a close relative of the East African Red-finned Barb (B. apleurogramma), it is currently under study for its formal description. Until then, this small African barb is provisionally assigned to the genus Barbus, but probably belongs – like "B." apleurogramma – in another genus.[1]

It is apparently endemic to Kenya. The only places where it has been found to date are N'joro Springs at the River Lumi in the upper Pangani River drainage basin. It might not occur elsewhere. Due to this limited distribution, it is classified as Vulnerable by the IUCN, but this may change when this fish becomes better known.[1]

See also[edit]

Other undescribed small barbs from Kenya:

Footnotes[edit]

  1. ^ a b Vreven (2006)

References[edit]

  • Vreven, E. (2006). Barbus sp. nov. 'Pangani'. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 25 September 2009.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Barbus sp. 'Nzoia 2'

Barbus sp. 'Nzoia 2' is an undescribed but distinct ray-finned fish species in the family Cyprinidae. It was first reported in 1999. A small African barb, it is provisionally assigned to the genus Barbus, but probably belongs – like similar species – in another genus.[1]

It is apparently endemic to Kenya. The only places where it has been found to date are in the Nzoia River drainage basin of the Lake Victoria region; it might occur elsewhere though. It may be a threatened species, but too little is known about its distribution, population size and taxonomy to judge its status with a higher level of certainty. Therefore, it is classified as Data Deficient by the IUCN, but this will change when this fish becomes better known.[1]

See also[edit]

Other undescribed small barbs from Kenya:

Footnotes[edit]

  1. ^ a b Vreven (2006)

References[edit]

  • Vreven, E. (2006). Barbus sp. nov. 'Nzoia 2'. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 25 September 2009.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Barbus sp. 'Nzoia'

Barbus sp. 'Nzoia' is an undescribed but distinct ray-finned fish species in the family Cyprinidae. It was first reported in 1999. A small African barb, it is provisionally assigned to the genus Barbus, but probably belongs – like similar species – in another genus.[1]

It ihas been found only in Kenya. The only places where it has been found to date are in the Nzoia River drainage basin of the Lake Victoria region. It might not occur elsewhere. Due to this limited distribution, it is classified as Vulnerable by the IUCN, but this may change when this fish becomes better known.[1]

See also[edit]

Other undescribed small barbs from Kenya:

Footnotes[edit]

  1. ^ a b Vreven (2006)

References[edit]

  • Vreven, E. (2006). Barbus sp. nov. 'Nzoia'. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 25 September 2009.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Barbus

Barbus is a ray-finned fish genus in the family Cyprinidae. The type species of Barbus is the common barbel, first described as Cyprinus barbus and now named Barbus barbus. Barbus is the namesake genus of the subfamily Barbinae, but given their relationships, that taxon is better included in the Cyprininae at least for the largest part (including the type species of Barbus).

Description and uses[edit]

Their common names – barbs and barbels – refer to the fact that most members of the genera have a pair of barbels on their mouths, which they can use to search for food at the bottom of the water.

Barbels are often fished for food; in some locations they are of commercial significance. The roe of barbels is poisonous, however. The large Barbus barbs are also often eaten in their native range.

At Shanhûr in Egypt, remains of a jar from the sixth to seventh century AD were unearthed which contained a bunch of fish bones. The fishes were apparently pickled to produce a dish similar to the modern fesikh (or faseekh). Among the ancient remains, barbs (perhaps Barbus perince) were plentiful, and Egyptians in our time still consider B. perince good for preparing fesikh, as it is traditionally done for the Sham el-Nessim (spring festival) celebrations.[1]

The smaller barbs are in some cases traded as aquarium fish. Some are quite significant, but as a whole, the genus is not yet as well represented in aquaria as the Southeast Asian Puntius.[2]

One species, Barbus microbarbis from Rwanda, is known to have gone extinct in recent times. Several others are only known from the type specimens, and their status and continuing existence must be confirmed. As many of these are from Lake Victoria, which underwent massive ecological upheaval after Nile perch (Lates nilosus) were introduced, it may well be that some of them have not survived, either.

Systematics and taxonomy[edit]

Barbus has a long history as a "wastebin genus". Historically, most fish commonly known as "barbs" were usually placed here by default. More recently, many "barbs" have been reclassified into genera such as Barbichthys, Barbodes, Barboides, Barbonymus (tinfoils), Barbopsis, Caecobarbus, Capoeta, Carasobarbus, Clypeobarbus, Hypselobarbus, Hypsibarbus, Labeobarbus (yellowfishes), Leptobarbus, Luciobarbus, Mesopotamichthys, Messinobarbus, Poropuntius, Probarbus, Pseudobarbus (redfins), Puntioplites and Puntius (spotted barbs, commonly kept in aquaria).[3]

Thus, Barbus is for the time being restricted to the typical barbels and barbs, and only contains fishes from Africa and Europe, as well as adjacent Asia. However, the genus even in the reduced version is probably paraphyletic, and many African species (particularly the small ones) do not seem to belong here either. Eventually, Barbus is likely to be restricted to the group around B. barbus – the large European to Ponto-Caspian species commonly known as "barbels". Luciobarbus and particularly Messinobarbus are highly similar and might better be included in Barbus again. They all seem to be close relatives – perhaps the closest living relatives – of the Dalmatian barbelgudgeon (Aulopyge huegelii). Carasobarbus and Labeobarbus are probably closely related to this group, too, and some large hexaploid barbs (e.g. B. reinii) presently placed in the present genus may well belong in Labeobarbus.

The small barbs from Africa, by contrast, are quite distinct. They might even warrant establishment of a new subfamily – in particular if the Labeoninae are not included in the Cyprinae –, as they seem to be as distinct from barbels and typical carps, as these are from the garras (which are part of the disputed Labeoninae), rendering the old "Barbinae" paraphyletic. Within the small African barbs, several linages can be recognized. These are mostly diploid; a tetraploid group largely restricted to southern Africa is very close to Pseudobarbus and might even be included therein. In particular, the group called "redfins" may well be monophyletic and belong in Pseudobarbus entirely, instead of being split between that genus and Barbus, as is presently done.

Species[edit]

There are currently 311 recognized species in this genus:[4][5]

Fossil species[edit]

There is a fossil species (Barbus megacephalus Günther, 1876) known from the Paleogene Sipang Fauna of Indonesia.[7]

See also[edit]

Footnotes[edit]

  1. ^ van Neer & Depraetere (2005)
  2. ^ Lambert (1997): p.14
  3. ^ Banister (1973)
  4. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Barbus in FishBase. October 2012 version.
  5. ^ a b Banyankimbona, G., Vreven, E. & Snoeks, J. (2012): Barbus’ devosi, new species from the Malagarazi River basin in Burundi and Tanzania, East Africa (Cypriniformes: Cyprinidae). Ichthyological Exploration of Freshwaters, 23 (2): 181-192.
  6. ^ Bamba, M., Vreven, E.J. & Snoeks, J. (2011): Description of Barbus teugelsi sp. nov. (Cypriniformes: Cyprinidae) from the Little Scarcies basin in Guinea, Africa. Zootaxa, 2998: 48–65.
  7. ^ Woodward, Arthur Smith (1901). Catalogue of the Fossil Fishes in the British Museum (Natural History). p. 302. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!