Overview

Brief Summary

Impossible de rater le Flambé, l'un de nos plus impressionnants papillons de jour. Surtout visibles en avril et en mai, puis en septembre pour la seconde génération, les adultes affectionnent en particulier les fleurs de lavande. On le rencontre globalement dans toute la France sauf quelques exceptions dans le Nord.  Observation en vol : Mai à août.  Nombre de générations par an : 2.  Milieux de vie : Haies, prairies, coteaux secs, broussailles.  Description Adulte  Envergure : 70-90 mm.  Apparence :  Mâle et femelle, identiques, sont de couleur jaune très pâle, avec des zébrures noires tout à fait caractéristiques. Les ailes arrière portent une longue queue noire terminée de blanc et des marques bleutées en forme de demi-lune. À l'arrière de l'abdomen, deux taches noires bordées d'orange (les « ocelles ») se rejoignent lorsque l'insecte déploie ses ailes, formant une sorte d'?il. C'est grâce à eux que le papillon peut surprendre ses prédateurs et parfois leur échapper.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Noé Conservation

Source: Noé Conservation

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

L'oeuf est sphérique, lisse et vert. Il devient brun juste avant l'éclosion. La femelle dépose ses oeufs un à un sur les feuilles de la plante hôte.   Chenille  Taille : 40-45 mm au dernier stade.  Apparence : Aux 2 premiers stades, la chenille est noire avec des taches blanches sur le dos. Par la suite, elle devient verte avec quelques taches brunes sur les flancs et le dos. La chenille possède aussi un osméterium, organe jaune orangé émettant une odeur repoussante et situé derrière la tête, qu'elle peut sortir en cas de menace pour faire fuir ses prédateurs.   Plantes hôtes : Arbustes de la famille des rosacées (prunelliers, merisiers, aubépines).  Chrysalide: Les chrysalides de Flambé sont attachées à leur support par une ceinture de soie ; elles sont anguleuses avec deux pointes sur les côtés de la tête. Deux colorations existent : les chrysalides des individus de la génération qui hiberne (génération printanière) sont brun clair et peuvent être découvertes sous toutes sortes d'abris (brindille, mur, branches...), et les chrysalides des individus de la deuxième génération (génération estivale) sont vertes et souvent fixées sur les tiges de la plante hôte.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Noé Conservation

Source: Noé Conservation

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Iphiclides podalirius

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGL0203-06|AF170873|Iphiclides podalirius| CGAAAATGACTTTATTCTACAAATCATAAAGATATTGGAACATTATATTTCATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCATTA---AGAATAATTATTCGAACTGAATTAGGTAATCCAGGTTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATA---TTAGGAGCTCCTGATATAGCATTTCCTCGTATAAATAATATAAGATTTTGATTATTACCCCCCTCTCTAATTCTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTCTACCCCCCACTATCATCTAATATTGCACATAGAGGAAGATCTGTTGATCTT---GCTATTTTTTCACTTCACTTAGCTGGTATTTCATCTATTTTAGGTGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTACTTTTATCTTTACCAGTATTAGCTGGA---GCTATTACCATATTACTTACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTACATTTTAATTTTACCAGGATTTGGTATAATCTCTCATATTATTTCTCAAGAAAGAGGAAAAAAA---GAAACATTTGGGTGTTTAGGAATAATTTATGCTATAATAGCAATTGGTTTATTAGGATTTATTGTATGAGCTCATCATATATTTACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Iphiclides podalirius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Species: 29
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Scarce Swallowtail

The Scarce Swallowtail (Iphiclides podalirius) is a Palearctic swallowtail butterfly found in gardens, fields and open woodlands. First described by Linnaeus in 1758, it is found in places with sloe thickets and particularly orchards. It is also called Sail Swallowtail or Pear-tree Swallowtail. The Southern Swallowtail (Iphiclides feisthamelii), is sometimes treated as a subspecies.

Contents

Distribution

It is widespread throughout Europe with the exception of the northern parts. Its range extends northwards to Saxony and central Poland and eastwards across Asia Minor and Transcaucasia as far as the Arabian peninsula, India, and western China. A few specimens of the Scarce Swallowtail have been reported from central Sweden and the UK but they were probably only strays and not migrants. The scarcity of UK migrants is responsible for the English common name. In the Alps it can be found up to altitudes of 1600 m.

The presence of Iphiclides podalirius in the floodplain of the Morava River in the Slovak Republic have been found to be a good indicator of relatively well preserved xerothermic grassland habitats with forest-steppe vegetation, which have no cutting history.[1]

Status

In some years the Scarce Swallowtail is quite abundant. The Scarce Swallowtail is getting rarer as the blackthorn bushes are being cleared. The butterfly is now protected by law in Czech republic, Slovakia, Germany, Hungary, Luxembourg, Russia and Poland.[2] It is considered Rare-Endangered and protected in some provinces of Austria and of status Indeterminate throughout Europe. Though referred by some authorities to be of status "Vulnerable",[1]:46[3] it is however unlisted in the IUCN Red List[4] and the CITES appendices I, II and III.[5]

Habits and life cycle

Scarce Swallowtail caterpillar
Pupa
Iphiclides podalirius01.jpg

The food plant includes hawthorn bushes. The caterpillars spin little pads on leaves and grip them firmly. The newly hatched caterpillar is dark in colour with two smaller and two bigger greenish patches on the dorsal side, later they are greenish with yellowish dorsal and side stripes. The summer chrysalids are green as a rule, the hibernating ones are brown. A number of hibernating chrysalids fall prey to various enemies.

The caterpillars of the Scarce Swallowtail have been noted to leave silk trails from the permanent resting sites to feeding sites. This has been seen in both solitary and territorial larves with larvae having the ability to discern their trails from those of others.[6]

Research on pupae of Iphiclides podalirius in Spain indicates that the pupae manifest in two colours, green and brown, for the purpose of camouflage. The green pupae develop on hostplants and develop directly while brown pupae enter into diapause in the leaf litter. Pupating larvae tend to form green pupae before August while after August they tend to form brown pupae. Duration of the Wiktionary:photophase or light period appears to be the mechanism which dictates the path of development of the pupa. The results suggest that the green pupa develop on foodplants to avoid predation by small mammals and visual avian predators while the brown pupa develop on leaf litter to avoid avian predators.[7]

See also

References

  • Collins, N.M., Morris, M.G. (1985) Threatened Swallowtail Butterflies of the World. IUCN. ISBN 2-88032-603-6

Links

References

  1. ^ a b Kulfan, Miroslav; Degma, Peter; Kalivoda, Henrik (1995). "Lepidoptera of different grassland types across the Morava floodplain". Journal of Research on the Lepidoptera 34: 39–47. http://lepidopteraresearchfoundation.org/pdf/pdf34/34-039.pdf. Retrieved 27 October 2010. 
  2. ^ Collins, N. Mark; Collins, Michael G. (1985). Threatened Swallowtails of the World: the IUCN red data book. IUCN Protected Area Programme Series. Gland, Switzerland and Cambridge, U.K.: IUCN. p. 45. ISBN 978-2-88032-603-6. http://books.google.co.in/books?id=RomV7uO_t9YC. Retrieved 22 October 2010. 
  3. ^ Popov, 1989. On research of Lepidoptera, Rhopalocera population of Carpathian State Reserve. /S.G. Popov// Information Report of thesis, IV Conference of young scientists. 1-3 of June 1989 devoted to 70 Anniversary of YCL. Uzhgorod, 1989:138.
  4. ^ A search for "Iphiclides" in the search facility of the IUCN Red List web site provides no result. Accessed 27 October 2010.
  5. ^ "Appendices I, II and III to CITES". Convention on Iinternational Trade on Endangered Species. As of 14 Oct 2010. http://www.cites.org/eng/app/appendices.shtml. Retrieved 23 September 2010. . No mention found in the dicument.
  6. ^ Weyh, R.; Maschwitz, U.. "Individual trail marking by larvae of the scarce swallowtail Iphiclides podalirius Lepidoptera; Papilionidae)". Oecologia 52 (3): 415-316. doi:10.1007/BF00367969. http://www.springerlink.com/content/l544110768432004/. 
  7. ^ Stefanescu, C. (2004). "Seasonal change in pupation behaviour and pupal mortality in a swallowtail butterfly". Animal Biodiversity and Conservation 27 (2): 25–36. http://w3.bcn.es/fitxers/icub/museuciencies/abc272pp2536.150.pdf. Retrieved 28 October 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!