Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sympetrum costiferum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCCTTCCCTCGATTAAATAATATAAGTTTTTGACTTTTACCCCCTTCTTTCACTCTTCTTTTATCCAGAAGTATGGTTGAAAGAGGGGCAGGAACTGGGTGAACTGTTTATCCTCCTTTAGCTGGTGCTATTGCTCACGCTGGGGCATCAGTAGACTTAACAATTTTCTCTTTACATCTTGCAGGAGTATCTTCAATTTTAGGTGCAATCAATTTTATTACTACAGTAATTAATATAAAATCCCCAGGGATAAAGCTAGATCAAATACCACTATTTGTATGAGCGGTAGTAATTACAGCAGTATTACTTTTATTATCATTACCTGTATTAGCTGGAGCCATTACTATACTATTAACTGATCGAAATATTAATACATCATTTTTTGACCCTGCAGGAGGGGGAGATCCTATTTTGTACCAGCATTTATTTTGATTTTTTGGTCATCCTGAAGTATATATTTTAATTTTACCAGGGTTTGGTATAATTTCTCATATCATTGCCCAAGAGAGAGGTAAAAAGGAAACATTTGGTGTGCTTGGAATAATTTATGCTATAGTAGCAATTGGAGTTTTAGGTTTTGTTGTATGAGCTCATCATATATTTACAGTAGGTATAGATGTAGATACTCGAGCATACTTCACCTCTGCTACAATAGTAATTGCTGTACCAACAGGAATTAAAATTTTCAGATGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sympetrum costiferum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sympetrum costiferum

The Saffron-winged Meadowhawk (Sympetrum costiferum) is a dragonfly of the genus Sympetrum. It is found across northern and central United States and most of Canada, including a southern portion of the Northwest Territories.

Its abdomen is yellowish-brown, turning pale red at maturity in both sexes. Juveniles and females have gold (saffron) coloured wing stripes.[1] Veins of males and females are reddish or orange.[2] The sides of the abdomen are marked with black triangles. Some females have amber in basal areas of their wings. Legs are striped in black and yellow or red. Size: 35 mm (1.4 in).[1] This species overlaps with and is difficult to distinguish from both the Ruby and White-faced Meadowhawks.[1]

Similar species

References

  1. ^ a b c Dunkle, S.W., Dragonflies through Binoculars: A Field Guide to Dragonflies of North America. New York:Oxford University Press, 2000.
  2. ^ Mead, Kurt. Dragonflies of the North Woods. Second edition. Duluth, MN:Kollath+Stensaas, 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!