Overview

Brief Summary

North American Ecology (US and Canada)

Found only in Hawaii (Scott 1986). Habitats are WOODLANDS AND CITIES. Host plants are largely restricted to one genus, Citrus, in family Rutaceae. Hosts are usually trees. Individuals overwinter as pupae. There are multiple flights throughout each year (Scott 1986).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Introduced to Hawaii in 1971 from Japan or Guam.
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Mostly around developed areas with Citrus in Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilio xuthus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 80 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGL3822-07|EF621724|Papilio xuthus| CGAAAATGACTTTATTCAACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTATTTGAGCAAGTATATTAGGAACTTCTCTT---AGTTTATTAATTCGAACTGAATTAGGAACCCCAGGTTCATTAATTGGTGAT---GATCAAATTTATAATACTATTGTTACAACTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATCCCATTAATA---TTAGGAGCCCCCGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTCTATTAATTTCCAGAATAATTGTTGAAAATGGAGCTGGAACTGGATGAACTGTTTACCCCCCTCTTTCTTCTAATATCGCACATGGTAGAAGATCAGTTGATTTA---GTTATTTTTTCCCTACATTTAGCAGGAATTTCTTCAATTCTTGGAGCAATTAATTTTATTACTACAATTATTAATATACGTATTAATAATATATCATTCGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTATTATTACTTCTCTCTTTACCAGTTTTAGCAGGT---GCTATTACCATATTATTAACAGATCGAAACTTAAATACATCTTTCTTTGATCCTGCTGGAGGGGGAGATCCTATTCTCTATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCGGGATTTGGAATAATTTCACATATCATTTCCCAAGAAAGTGGAAAAAAA---GAAACATTTGGGTGTTTAGGAATAATTTATGCTATAATAGCAATTGGATTATTAGGTTTTATTGTTTGAGCTCATCACATATTTACTGTTGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Papilio xuthus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 80
Species: 81
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Papilio xuthus

Papilio xuthus, also known as the Asian Swallowtail, Chinese Yellow Swallowtail, or as the Xuthus swallowtail, is a middle to large sized swallowtail butterfly found in northeast Asia, Korea, Japan, and Hawaii.

Contents

Description

A mid-sized, yellow, prominently tailed butterfly. It has a wingspan of 45 to 55 mm.

Range

Northern Myanmar, southern China, Japan(from Hokkaidō to Yaeyama Islands), Taiwan, Guam, Ogasawarashoto, Korean Peninsula, maritime province of Siberia, and the Hawaiian Islands.[1]

Similar species

Status

Common and not threatened.[1]

Habitat

Papilio xuthus is common in urban, suburban, woods, and orange orchards.

Life cycle

The caterpillar of P. xuthus is very similar to the caterpillar of the Spangle Papilio protenor, however, the color of the osmeterium of P. xuthus is orange yellow, and the color of the osmeterium of P. protenor is ruby red.

The pupa is usually green or brown depending on the roughness of the perch. Pupation takes place after the larval duration of 2 weeks.

Food plants

The larvae of the species feed on plants of Family Rutaceae. Recorded species of foodplants include:

References

  1. ^ a b Collins, N. Mark; Collins, Michael G. (1985). Threatened Swallowtails of the World:the IUCN red data book. IUCN Protected Area Programme Series. Gland, Switzerland and Cambridge, U.K.: IUCN. p. 95. ISBN 978-2-88032-603-6. http://books.google.co.in/books?id=RomV7uO_t9YC. Retrieved 22 October 2010. 
  2. ^ a b c d e f Savela, Marrku (16 Feb 2008). "Papilio". Lepidoptera and some other life forms. nic.funet.fi. http://www.nic.funet.fi/pub/sci/bio/life/insecta/lepidoptera/ditrysia/papilionoidea/papilionidae/papilioninae/papilio/index.html#xuthus. Retrieved 09 November 2010. 

See also


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!