Overview

Brief Summary

North American Ecology (US and Canada)

Resident in western North America (Scott 1986). Habitats are DECIDUOUS WOODED AREAS. Host plants include species from many families. Hosts are shrubs or trees. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There are multiple flights each year with the approximate flight time JUN1-AUG30 in the northern part of the range and MAR1-SEP30 in the southern part of their range (Scott 1986). Listed as a subspecies of Papilio glaucus by some sources (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

General Description

In Alberta, this species is likely to be encountered only in the southern mountains south of the Crowsnest Pass, where the very similar Canadian Tiger Swallowtail (P. canadensis) also flies. The Western Tiger has yellow rather than red crescents along the margin of the hindwing underside, has a thicker black cap to the orange spot in the hindwing anal spot, and has a predominantly black rather than yellow forewing fringe.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Ranges from southern BC south throughout the western US (Opler 1999). The first confirmed Alberta specimen of this species was collected by Ted Pike in the Castle River region in 2002 (B.C. Schmidt, unpubl. data).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) West of Rocky Mountains, from British Columbia south to Baja California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Syntype for Papilio rutulus Boisduval, 1852
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male; Adult
Preparation: Pinned
Collector(s): Unknown
Locality: Unknown, California, United States
  • Syntype: 1852. Annales de la Société Entomologique de France. 10 (2): 279.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Montane woodlands and along water courses.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: General in wooded areas, normally near moisture. Typical habitats include wooded areas near streams and rivers and wooded residential areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

The Adults are avid flower visitors and males often mud-puddle (Guppy & Shepard 2001). Larvae feed on a variety of shrubs in B.C., including alder, apple, birch, cherry, poplar and willows (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

feed mainly from nectar or carrion. Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

One yearly flight, peaking in June.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The eggs are smooth, green and round, laid singly on the host plant (Pyle 2002). Mature larvae are velvety green with a pair of yellow-rimmed eyespots and a yellow stripe on the mid-thoracic segment (Pyle 2002). The tan and brown-streaked pupa overwinters (Pyle 2002). This species tends to have an extended emergence period and a longer lifespan than smaller species (Pyle 2002).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilio rutulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCATAAAGATATTGGAACATTATACTTCATTTTTGGAATTTGAGCAAGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGAGCACCTGATATAGCCTTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAACTCTTTTAATTTCAAGAATAATCGTTGAAAGAGGGGCCGGAACTGGATGAACTGTTTATCCTCCTCTTTCTTCTAATATCGCTCATGGAAGAAGATCAGTAGATTTAGTTATTTTTTCCCTTCATTTAGCAGGAATTTCTTCAATTTTAGGGGCAATTAATTTTATTACTACAATTATTAATATACGAATCAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTCTATTATTACTTCTTTCATTACCTGTTTTAGCCGGAGCTATCACAATACTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTTTGATTCTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTTCTCAAGAAAGAGGAAAAAAAGAAACATTTGGATGTTTAGGTATAATTTATGCTATAATAGCAATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAGACACAGATACTCGAGCTTATTTTACCTCAGCAACAATAATTATTGCAGTTCCTACAGGAATTAAAATTTTTAGTTGATTAGCAACTCTTCATGGAACT---CAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Papilio rutulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Biological Research Needs: None.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: None.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Papilio rutulus

The Western Tiger Swallowtail (Papilio rutulus) is a common swallowtail butterfly of western North America, frequently seen in urban parks and gardens as well as in rural woodlands and riparian areas. It is a member of the Papilio genus, of which Papilio appalachiensis and Papilio xuthus are also members. It is a large, brightly colored and active butterfly, rarely seen at rest; its wingspan is 7 to 10 cm (~2.75 to 4 in), and its wings are yellow with black stripes, and in addition it has blue and orange spots near its tail. It has the "tails" on the hind wings that are often found in swallowtails.

Papilio rutulus

The eggs are deep green, shiny and spherical. They are laid singly, on the undersides of leaves. The caterpillars emerge about four days later. Young caterpillars resemble bird droppings, and as they molt they eventually turn bright green, with a pair of large yellow eyespots with black and blue pupils. They can feed on the leaves of a variety of trees, and the predominant foodplant varies across their range; trees commonly used include cottonwood, willow, quaking aspen and many others. The caterpillars molt 5 times, eventually reaching a length of up to 5 cm before pupating. In summer, the butterfly can emerge as little as 15 days after the caterpillar pupated, but when the caterpillar pupates in the fall, the butterfly will not emerge until the spring. The chrysalis is green in summer and dark brown in winter, and looks like a piece of wood. Butterflies emerge from winter chrysalids between February and May, the date depending on the temperature, so they are seen earlier in the more southerly and more coastal parts of their range. The adult females lay up to a hundred eggs in total. The males often congregate, along with other species of swallowtail at pools and along streams and rivers; they drink from the water and mud, extracting minerals as well as moisture.

Western Tiger Swallowtail, photographed in British Columbia
Western Tiger Swallowtail, photographed in Vancouver, Washington

The normal range of the Western Tiger Swallowtail covers much of western North America, from British Columbia to North Dakota in the north to Baja California and New Mexico in the south. Individuals occasionally turn up east of this range; however, in general, in eastern North America, it is replaced by the similar Eastern Tiger Swallowtail, Papilio glaucus.

Like the other tiger swallowtails, the Western Tiger Swallowtail was formerly classified in genus Pterourus, but modern classifications all agree in placing them within Papilio.

See also[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!