Overview

Brief Summary

North American Ecology (US and Canada)

Year-round resident in eastern North America as far north as southern Canada, with some migratory sections extending the range to the north and west (Scott 1986). Habitats are DECIDUOUS WOODLANDS. Host plants are largely restricted to a few species mostly in famiies, LAURACEAE and MAGNOLIACEAE. Hosts can be shrubs or trees. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There are multiple flights each year with the approximate flight time MAY15-SEP15 in the northern part of the range and MAR1-DEC31 in the southern part of their range (Scott 1986).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Spicebush swallowtails (Papilio troilus) are found in eastern North America from southern Canada to Florida, and west to Oklahoma, Manitoba, and central Texas. This species is less common on the western edge of its range, along the southern Mississippi River, as well as in New England. Occasionally these butterflies are found as far west as Colorado, and as far south as Cuba.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Spicebush swallowtails (Papilio_troilus) are found in eastern North America from southern Canada to Florida, and west to Oklahoma, Manitoba, and central Texas. This species is less common on the western edge of its range, along the southern Mississippi River, as well as in New England. Occasionally these butterflies are found as far west as Colorado, and as far south as Cuba.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

In adults, the upper surface of the forewing is mostly black, with ivory spots along the bottom margin. The upper surface of the hindwing has an orange spot on the costal margin which is unique to spicebush swallowtails. There is also a band of bluish (female) or bluish-green (male) scales on the upper surface of the hindwing. The bottom margin of the hindwing has bluish or ivory spots, and also a “tail” measuring 9 to 12 mm long at the bottom of the wing. This feature is similar to other swallowtails such as black swallowtails (Papilio asterius) and pipevine swallowtails (Battus philenor). However, the "tail" in P. troilus is broader and spatulate. Wingspan ranges from 80 to 115 mm.

The larval or caterpillar form initially resembles bird droppings, but in later instars is green with a pale yellow lateral line running the length of the caterpillar. The underside of the caterpillar is pinkish-brown, and each abdominal segment is ringed by six blue spots outlined in black. One dot on each side is below the yellow lateral line.

Caterpillars have two pairs of false eyespots: one pair is toward the back of the thorax, and is small and yellow. The other pair is closer to the head, and is yellow with a black spot in the middle, and a white spot that resembles the glare off a black eye. The combination of the eyespots and a swollen thorax is believed to be a mimicry of either green snakes or tree frogs.

Female caterpillars are often slightly longer than males. Pupae can be brown or green depending on the season, mimicking leaves of spring and fall, and have a pair of horns at the top of the pupa.

Range wingspan: 80 to 115 mm.

Average wingspan: 100 mm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Other Physical Features: ectothermic ; bilateral symmetry

  • Nitao, J., M. Ayres, R. Lederhouse, J. Scriber. 1991. Larval Adaptation to Lauraceous Hosts: Geographic Divergence in the Spicebush Swallowtail Butterfly. Ecology, 72/4: 1428-1435. Accessed November 19, 2005 at http://www.jstor.org/view/00129658/di960339/96p0029c/0.
  • Saunders, A. 1932. Butterflies of the Allegany St. Park. Albany, NY: The University of the State of New York.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

In adults, the upper surface of the forewing is mostly black, with ivory spots along the bottom margin. The upper surface of the hindwing has an orange spot on the costal margin which is unique to spicebush swallowtails. There is also a band of bluish (female) or bluish-green (male) scales on the upper surface of the hindwing. The bottom margin of the hindwing has bluish or ivory spots, and also a “tail” measuring 9 to 12 mm long at the bottom of the wing. This feature is similar to other swallowtails such as black swallowtails (Papilio_asterius) and pipevine swallowtails (Battus_philenor). However, the "tail" in P._troilus is broader and spatulate. Wingspan ranges from 80 to 115 mm.

The larval or caterpillar form initially resembles bird droppings, but in later instars is green with a pale yellow lateral line running the length of the caterpillar. The underside of the caterpillar is pinkish-brown, and each abdominal segment is ringed by six blue spots outlined in black. One dot on each side is below the yellow lateral line.

Caterpillars have two pairs of false eyespots: one pair is toward the back of the thorax, and is small and yellow. The other pair is closer to the head, and is yellow with a black spot in the middle, and a white spot that resembles the glare off a black eye. The combination of the eyespots and a swollen thorax is believed to be a mimicry of either green snakes or tree frogs.

Female caterpillars are often slightly longer than males. Pupae can be brown or green depending on the season, mimicking leaves of spring and fall, and have a pair of horns at the top of the pupa.

Range wingspan: 80 to 115 mm.

Average wingspan: 100 mm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The larval form of P. troilus is found in deciduous woodlands, wooded swamps, and pine barrens. The adult form is a fairly common butterfly within its range, that can be seen in woodlands, parks, yards, fields, and roadsides, but prefers the borders of shady woods. Males are often found near moist, sandy areas along roads or streams.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: marsh ; swamp ; bog

Other Habitat Features: urban ; suburban ; agricultural

  • Allen, T. 1997. The Butterflies of West Virginia and their Caterpillars. Pittsburg, PA: University of Pittsburg Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Woods, forest edges, pine barrens, old fields with sassafras. Only places with substantial larval foodplants are actual breeding habitats which means most use of suburban settings is casual. Among the few butterflies commonly breeding in true forest interiors eastward but also quite typical of more open woodland, thickets etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The larval form of P._troilus is found in deciduous woodlands, wooded swamps, and pine barrens. The adult form is a fairly common butterfly within its range, that can be seen in woodlands, parks, yards, fields, and roadsides, but prefers the borders of shady woods. Males are often found near moist, sandy areas along roads or streams.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: marsh ; swamp ; bog

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

As in many animals that undergo metamorphosis, the diet of the young differs from the diet of the adult.

In P. troilus, larvae feed on the leaves of aromatic trees and shrubs in the family Lauraceae. Their primary hosts are spicebush (Lindera benzoin), sassafras (Sassafras albidum), but they are also known to feed on camphor (Cinnamomum camphora) sweetbay (Magnolia virginiana), and redbay (Persea borbonia). The choice of host plant depends primarily on host availability in a particular part of the range. There is evidence of geographic divergence among populations with larval adaptation to the most common host species.

Adult P. troilus butterflies feed on nectar, and are partial to honeysuckle, clover, and thistle flowers. Their unusually long proboscis allows them to reach nectar in unusually deep flowers such as bee balm. They will also drink nectar from other flowers such as jewelweed, milkweed, azalea, dogbane, mimosa, and sweet pepperbush.

Plant Foods: leaves; nectar

Primary Diet: herbivore (Folivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

As in many animals that undergo metamorphosis, the diet of the young differs from the diet of the adult.

In P._troilus, larvae feed on the leaves of aromatic trees and shrubs in the family Lauraceae. Their primary hosts are spicebush (Lindera_benzoin), sassafras (Sassafras_albidum), but they are also known to feed on camphor (Cinnamomum_camphora) sweetbay (Magnolia_virginiana), and redbay (Persea_borbonia). The choice of host plant depends primarily on host availability in a particular part of the range. There is evidence of geographic divergence among populations with larval adaptation to the most common host species.

Adult P._troilus butterflies feed on nectar, and are partial to honeysuckle, clover, and thistle flowers. Their unusually long proboscis allows them to reach nectar in unusually deep flowers such as bee balm. They will also drink nectar from other flowers such as jewelweed, milkweed, azalea, dogbane, mimosa, and sweet pepperbush.

Plant Foods: leaves; nectar

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Papilio troilus in Illinois

Papilio troilus Linnaeus: Papilionidae, Lepidoptera
(observations are from Robertson, Hilty, Clinebell & Bernhardt, Clinebell, Smith & Snow, Hapeman, Stoutamire, Macior, Fothergill & Vaughn; this butterfly is the Spicebush Swallowtail)

Apiaceae: Eryngium yuccifolium sn (Rb); Asclepiadaceae: Asclepias incarnata [plpr sn] (Rb), Asclepias purpurascens [plab sn] (Rb), Asclepias tuberosa [plpr sn] (Rb); Asteraceae: Arctium minus sn (H), Cirsium altissimum sn (Rb), Cirsium hillii sn (Rb), Cirsium vulgare sn (Rb), Coreopsis palmata sn (Rb), Echinacea purpurea sn (Rb), Liatris aspera sn (Rb), Silphium integrifolium sn (H), Silphium perfoliatum sn (Rb), Taraxacum officinale sn (FV), Vernonia fasciculata sn (Rb), Vernonia × illinoensis sn (H); Balsaminaceae: Impatiens capensis sn (Rb); Boraginaceae: Mertensia virginica sn (Rb); Caesalpiniaceae: Gymnocladus dioicus sn (Rb); Campanulaceae: Lobelia cardinalis sn (Rb); Caryophyllaceae: Saponaria officinalis sn (Rb); Convolvulaceae: Ipomoea pandurata sn (Rb); Lamiaceae: Monarda bradburiana sn (Rb), Monarda fistulosa sn (Rb, H, Cl), Scutellaria ovata bracteata sn np (Rb); Liliaceae: Lilium michiganense sn (Rb); Orchidaceae: Platanthera blephariglottis sn (SS), Platanthera ciliaris sn fq (SS), Platanthera grandiflora sn (Stm), Platanthera peramoena sn (Hpm); Polemoniaceae: Phlox divaricata laphamii sn (Rb), Phlox pilosa sn (Rb); Ranunculaceae: Delphinium tricorne sn fq np (Rb, Mc); Rosaceae: Porteranthus stipulatus sn (Rb); Rubiaceae: Cephalanthus occidentalis sn (Rb); Scrophulariaceae: Penstemon digitalis sn np (Rb, CB), Penstemon tubaeflorus sn (CB); Verbenaceae: Verbena stricta sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spicebush swallowtail larvae are specialist herbivores, feeding on members of the family Lauraceae. Adults are generic pollinators for many flowers, inadvertently pollinating while feeding on nectar.

Ecosystem Impact: pollinates

Species Used as Host:

  • Lauraceae (as larval food plants)

Mutualist Species:

  • Angiosperms (as pollinators)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although spicebush swallowtails employ extensive mimicry throughout their lifecycles, mimicking bird droppings and green snakes as caterpillars, and mimicking the poisonous pipevine swallowtail (Battus philenor) as adults, they suffer from extensive predation. Spiders, insect predators such as dragonflies and robber flies, and especially birds, will eat swallowtail butterfly adults and larvae.

Known Predators:

  • Birds
  • Spiders
  • Dragonflies
  • Robber flies

Anti-predator Adaptations: mimic; cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Spicebush swallowtail larvae are specialist herbivores, feeding on members of the family Lauraceae. Adults are generic pollinators for many flowers, inadvertently pollinating while feeding on nectar.

Ecosystem Impact: pollinates

Species Used as Host:

  • Lauraceae (as larval food plants)

Mutualist Species:

  • Angiosperms (as pollinators)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Although spicebush swallowtails employ extensive mimicry throughout their lifecycles, mimicking bird droppings and green snakes as caterpillars, and mimicking the poisonous pipevine swallowtail (Battus_philenor) as adults, they suffer from extensive predation. Spiders, insect predators such as dragonflies and robber flies, and especially birds, will eat swallowtail butterfly adults and larvae.

Known Predators:

  • Birds
  • Spiders
  • Dragonflies
  • Robber flies

Anti-predator Adaptations: mimic; cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Females use both visual and chemical cues when finding hosts plants on which to oviposit. After landing on a plant, a female confirms the plant as a host plant by drumming the surface of the leaf with her forelegs, which have contact chemorecepters located on the foretarsi.

Information on communication between individuals is limited to mating contexts. Males apparently recognize females visually. The courtship display of a male involves many visual elements. In additon, during the process of mating itself, there is some contact, probably relaying information between the individuals.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: mimicry

Perception Channels: visual ; tactile ; chemical

  • Feeny, P. 1995. Ecological Opportunism and Chemical Constraints on the Host Associations of Swallowtail Butterflies. Pp. 9-15 in J Scriber, Y Tsubaki, R Lederhouse, eds. Swallowtail Butterflies: Their Ecology and Evolutionary Biology. Gainesville, FL: Scientific Publishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Females use both visual and chemical cues when finding hosts plants on which to oviposit. After landing on a plant, a female confirms the plant as a host plant by drumming the surface of the leaf with her forelegs, which have contact chemorecepters located on the foretarsi.

Information on communication between individuals is limited to mating contexts. Males apparently recognize females visually. The courtship display of a male involves many visual elements. In additon, during the process of mating itself, there is some contact, probably relaying information between the individuals.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: mimicry

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adults feed mainly from nectar and mud. Males patrol for females (Scott, 1986).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Spicebush swallowtails lay their eggs on the undersides of leaves. Larvae hatch and initially resemble bird droppings, but come to mimic a snake, complete with eyespots, in later instars. These larvae form pupae which are green (summer) or brown (fall) and metamorphose into butterflies. Some pupae hibernate over winter, and these are usually brown to mimic dead leaves. Shorter photoperiods associated with the coming of winter trigger pupae to assume the brown color, regardless of whether the leaf they live on is green or brown.

Papilio troilus produces two generations per year from April to October, except in Florida, where three are possible between March and December.

Development - Life Cycle: metamorphosis ; diapause

  • Hazel, W. 1995. The Causes and Evolution of Phenotypic Plasticity in Pupal Colar in Swallowtail Butterflies. Pp. 205-210 in J Scriber, Y Tsubaki, R Lederhouse, eds. Swallowtail Butterflies: Their Ecology and Evolutionary Biology. Gainesville, FL: Scientific Publishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Spicebush swallowtails lay their eggs on the undersides of leaves. Larvae hatch and initially resemble bird droppings, but come to mimic a snake, complete with eyespots, in later instars. These larvae form pupae which are green (summer) or brown (fall) and metamorphose into butterflies. Some pupae hibernate over winter, and these are usually brown to mimic dead leaves. Shorter photoperiods associated with the coming of winter trigger pupae to assume the brown color, regardless of whether the leaf they live on is green or brown.

Papilio_troilus produces two generations per year from April to October, except in Florida, where three are possible between March and December.

Development - Life Cycle: metamorphosis ; diapause

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Adult swallowtail butterflies live roughly from 2 days to 2 weeks.

Typical lifespan

Status: wild:
2 to 14 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Adult swallowtail butterflies live roughly from 2 days to 2 weeks.

Typical lifespan

Status: wild:
2 to 14 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In order to find females, males patrol flyways on hilltops or host plant sites. When patrolling males meet, they generally fly in opposite directions. Females have much lower representations in these areas. The only areas of equal representation are nectar sources. When a female appears, a male flies towards her and performs a brief courtship ritual, lasting less than a minute. If the female is receptive to the courtship, copulation occurs, often lasting over an hour. Both males and females often copulate with multiple partners. A fertilized female oviposits in the warm portion of the day, laying eggs singly on young host leaves.

Mating System: polygynandrous (promiscuous)

Spicebush swallowtails breed after becoming adults. This takes place during the summer months (April to October, or March to December in the southern part of the range) when there is ample food for the larvae. Though both males and females copulate with multiple partners, females are increasingly less likely to seek another mate with each successful copulation. Females search out host plants by visual and chemical cues, then land on a plant and drum the leaf with their forelegs to "taste" it, and confirm it as a host plant.

Breeding interval: Males mate daily. A females may mate multiple times during her lifetime.

Breeding season: Breeding occurs between April and October.

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous ; sperm-storing

Care of eggs once they are laid, or of larvae, does not occur in this species. However, females do invest in their young by producing nutrient rich eggs to allow the larvae to develop until hatching. They also select host plants carefully, to help ensure the survival of their young.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female)

  • Allen, T. 1997. The Butterflies of West Virginia and their Caterpillars. Pittsburg, PA: University of Pittsburg Press.
  • Hall, D., J. Butler. 2000. "spicebush swallowtail - Papilio troilus Linnaeus" (On-line). Accessed November 19, 2005 at http://creatures.ifas.ufl.edu/bfly/spicebush_swallowtail.htm.
  • Lederhouse, R. 1995. Comparative Mating Behavior and Sexual Selection in North American Swallowtail Butterflies. Pp. 117-131 in J Scriber, Y Tsubaki, R Lederhouse, eds. Swallowtail Butterflies: Their Ecology and Evolutionary Biology. Gainesville, FL: Scientific Publishers.
  • Nishida, R. 1995. Oviposition Stimulants of Swallowtail Butterflies. Pp. 17-26 in J Scriber, Y Tsubaki, R Lederhouse, eds. Swallowtail Butterflies: Their Ecology and Evolutionary Biology. Gainesville, FL: Scientific Publishers.
  • Struttman, J. 2004. "Butterflies of North America" (On-line). Northern Prairie Wildlife Research Center. Accessed November 19, 2005 at http://www.npwrc.usgs.gov/notfound/bflymoth.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In order to find females, males patrol flyways on hilltops or host plant sites. When patrolling males meet, they generally fly in opposite directions. Females have much lower representations in these areas. The only areas of equal representation are nectar sources. When a female appears, a male flies towards her and performs a brief courtship ritual, lasting less than a minute. If the female is receptive to the courtship, copulation occurs, often lasting over an hour. Both males and females often copulate with multiple partners. A fertilized female oviposits in the warm portion of the day, laying eggs singly on young host leaves.

Mating System: polygynandrous (promiscuous)

Spicebush swallowtails breed after becoming adults. This takes place during the summer months (April to October, or March to December in the southern part of the range) when there is ample food for the larvae. Though both males and females copulate with multiple partners, females are increasingly less likely to seek another mate with each successful copulation. Females search out host plants by visual and chemical cues, then land on a plant and drum the leaf with their forelegs to "taste" it, and confirm it as a host plant.

Breeding interval: Males mate daily. A females may mate multiple times during her lifetime.

Breeding season: Breeding occurs between April and October.

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous ; sperm-storing

Care of eggs once they are laid, or of larvae, does not occur in this species. However, females do invest in their young by producing nutrient rich eggs to allow the larvae to develop until hatching. They also select host plants carefully, to help ensure the survival of their young.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Eye spots deter animals: spicebush swallowtail
 

Eyespots of the spicebush swallowtail butterfly caterpillar protect it from predators because their tear shape creates an illusion of movable, watchful eyes.

 
  "The directionality of P. troilus's stare is achieved through a very simple design feature: the shape of the dark pupillary marking in the center of the eye. That marking, instead of being circular as it commonly is in actual eyes, is tear-shaped in the caterpillar's imitative version. It consists essentially of two portions: the basic circular marking, and a triangular anterior add-on that merges seamlessly with it. Leave out the add-on, and you have an eye with a circular pupil that is not nearly as able to convey the impression of looking forward or to the side." (Eisner 2003:96-97)
  Learn more about this functional adaptation.
  • Eisner, T. 2005. For Love Of Insects. Cambridge, MA: The Belknap Press of Harvard University Press. 448 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Papilio troilus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTATTCCACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAAGAATATTAGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGAAATTGACTAGTACCTTTAATACTCGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACACTTTTAATTTCAAGAATAATTGTTGAAAATGGAGCTGGCACTGGTTGAACTGTTTACCCACCCCTTTCTTCTAACATTGCCCATGGAAGAAGATCAGTTGATTTAGTAATTTTCTCTCTTCATCTAGCCGGAATTTCCTCTATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATCAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTACTTTTATCATTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAACTTAAATACATCATTCTTTGACCCTGCTGGAGGAGGAGATCCAATTCTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCACATTATTTCCCAAGAAAGAGGAAAAAAAGAAACATTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGATTATTAGGATTCATTGTTTGAGCTCATCACATATTTACAGTAGGGATAGATACTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Papilio troilus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The Nature Conservancy ranks spicebush swallowtails as a G5 species, which means that they are in no danger on a global scale, though may be quite rare in parts of the species' range, especially on the periphery.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Nature Conservancy ranks spicebush swallowtails as a G5 species, which means that they are in no danger on a global scale, though may be quite rare in parts of the species' range, especially on the periphery.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Spicebush swallowtails are not usually considered pests, though their host trees occasionally suffer slightly when planted as ornamentals.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Swallowtail butterflies have a slow and lazy flight, and because of this, they are easy to catch, making them prime collector's items. They are also popular photography subjects because of their large size, showiness, and slow flight. Since spicebush swallowtails are generic pollinators, they are also beneficial to crops.

Positive Impacts: research and education; pollinates crops

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Spicebush swallowtails are not usually considered pests, though their host trees occasionally suffer slightly when planted as ornamentals.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Swallowtail butterflies have a slow and lazy flight, and because of this, they are easy to catch, making them prime collector's items. They are also popular photography subjects because of their large size, showiness, and slow flight. Since spicebush swallowtails are generic pollinators, they are also beneficial to crops.

Positive Impacts: research and education; pollinates crops

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Papilio troilus

The Spicebush Swallowtail (Papilio troilus) is a common black swallowtail butterfly found in North America, also known as the Green-Clouded butterfly.[1] It has two subspecies, Papilio troilus troilus and Papilio troilus ilioneus, the latter found mainly in the Florida peninsula.[2] The spicebush swallowtail derives its name from its most common host plant, the spicebush, members of the genus Lindera.

The family to which Spicebush Swallowtails belong, Papilionidae, or swallowtails, include the largest butterflies in the world. The swallowtails are unique in that even while feeding, they continue to flutter their wings. Unlike other swallowtail butterflies, Spicebushes fly low to the ground instead of at great heights.[3]

Range[edit]

The Spicebush Swallowtail is found only in the eastern US and southern Ontario, but occasionally strays as far as the American Midwest, Cuba, Manitoba and Colorado.[3] While still larvae, Spicebush Swallowtail remain on the leaf of the plant on which they were laid. As adults, the butterflies do not limit their flight geographically and instead are motivated mostly by availability of water and nectar and mates within the species’ range.[4]

This primarily black swallowtail is normally found in deciduous woods or woody swamps, where they can be found flying low and fast through shaded areas. Females tend to stay in open plains,[5] while males are typically found in swamp areas.[4]

Papilio troilus troilus[edit]

The more widespread subspecies of Spicebush Swallowtail is prevalent throughout the Eastern United States, from New England to Wisconsin, west to Illinois, Wisconsin, North Dakota and Nebraska. It also abounds in Texas and Colorado.[6] Temperature may be a limiting factor for the spread of P. troilus troilus, as in experimental conditions, they do not fare well at or above 36 °C nor are they capable of flourishing at or below 14 °C.[7]

Papilio troilus ilioneus[edit]

The smaller subspecies of P. troilus is confined to the Southeastern coastal United States, namely throughout Florida and along coastal Georgia and in places in Texas.[6]

Physical description[edit]

Spicebush Swallowtail, Papilio troilus
Spicebush Swallowtail, Papilio troilus

P. troilus troilus[edit]

Typically, the wingspan of a Spicebush Swallowtail ranges from 3-4 inches.[8] Adults are primarily black/brown in color, with a trademark green-blue (male) or bright blue (female) splotch in the shape of a half moon on the hind-wings. The forewing has a border of cream-colored, oval spots. In the middle portion of the wing, the spots can be moon-shaped and a light blue in color.[6] Both sexes have cream-yellow moon-shaped spots on the edges of the hind-wings and a bright, orange spot at the base of the wings.[9] In females, the orange spot at the base of the wings will turn a greenish-white shade in summer, but not the spring.

On the underside of the hindwing, there will be a dual row of orange spots, which distinguishes it from the pipevine swallowtail, which only has a single row of spots. In between these rows, there is more blue or green coloring.[6]

P. troilus ilioneus[edit]

The distinguishing difference in color between the two subspecies is evident where the spots, which are blue in color on the hindwing of the P. troilus troilus, are more yellow in color in the ilioneus subspecies. Additionally, splashes of blue can trail all the way down the tail of the ilioneus.[6]

Habitat[edit]

The host plants of the Spicebush Swallowtail are most commonly either spicebush (Lindera benzoin) or sassafras (Sassafras albidum).[10] Other possible host plants include Prickly Ash (Zanthoxylum),[11] as well as tulip tree (Liriodendron tulipfera), sweetbay (Magnolia virginiana), camphor (Cinnamomum camphora) and redbay (Persea borbonia).[8] Redbay and Swampbay are the primary host plants for members of the Papilio troilus ilioneus strain, while spicebush and sassafras as the primary hosts for Papilio troilus troilus.[12] However, when given the choice between spicebush and sassafras, the P. troilus troilus showed no significant preference for either.[13]

Additionally, P. troilus ilioneus live only on redbay because that is the primary host plant within the Southern range. However, in a test of P. troilus troilus and P. troilus ilioneus on redbay, sassafras and spicebush, although the P. troilus ilioneus had higher growth and survival rates on redbay than the P. troilus troilus, as a holistic group, both subspecies performed better on sassafras or spicebush over time.[5]

In general, Spicebush Swallowtails tend to stick to plants that are members of the family Lauraceae. The preference for Lauraceae is so consistent among Spicebush Swallowtails that under experimental conditions, when placed in an environment with leaves other than Lauraceae, P. troilus died without eating anything.[14] This fact is especially noteworthy because Lauraceae are distantly related to the host plants of other species that are food for Papilio caterpillars.[15] The fact that spicebush swallowtails live and feed primarily on Lauraceae only is noteworthy also because most other varieties of swallowtail butterflies are nowhere near as specific. Part of the reason for the selective nature of P. troilus and host plants may have to do with the requirement of positive stimuli to confirm that a plant is Lauraceae among P. troilus before they will feed on it, while P. glaucus, for example, will at once try to feed on any plant presented to it.[5]

The insistence on feeding primarily on Lauraceae has its advantages for Spicebush Swallowtails. They are able to feed 2-4 times more adeptly and efficiently on Lauraceae than P. glaucus on the same plant, for example, who feed on Lauraceae as well as other types of plants. In addition, there has not been any other Lepidoptera species which feeds as efficiently as the P. troilus on spicebush.[14] However, none of the host plants of Papilio troilus occur throughout the full range of the Spicebush Swallowtail. As stated above, the P. troilus ilioneus strain, found in Florida, mostly feeds on redbay, while P. troilus troilus feeds on either sassafras or spicebush. In a study, it was found that those spicebush swallowtails that normally feed on redbay did not grow as well on spicebush or sassafras during the first instar of development, while all insects studied grew better throughout the larval period on sassafras or spicebush. In addition, the ilioneus strain was typically larger in size than the troilus.[12]

In a recent study, 3-trans-Caffeoyl-muco-quinic acid was found to be the substance that compelled Spicebush Swallowtails to lay their eggs on members of Lauraceae. However, 3-trans-Caffeoyl-muco-quinic acid is a component of the extract from sassafras plants but not from spicebush, redbay or camphortree, the other top three host plants of Spicebush Swallowtails. This substance is not necessarily itself the stimulant but instead activates another as yet unknown compound that thus compels the Spicebush Swallowtail to lay eggs. Thus, this substance may hold the link for why some Spicebush Swallowtails prefer to lay eggs on sassafras rather than spicebush. In addition, 3-trans-Caffeoyl-muco-quinic acid is a member of a family of acids, hydroxycinnamic acids, which are present in oviposition stimulants for some members of all five families of swallowtail butterflies. Hydroxycinnamic acids are also present in the extracts from host plants for two other species within the genus Papilio: the black swallowtail butterly, P. polyxenes, and P. protenor. Thus, hydroxycinnamic acids may help explain why many types of swallowtails choose to oviposit on the plants that they choose.[15]

Food sources[edit]

Spicebush Swallowtail gain sustenance from eight major sources. Here are some examples: eating the leaves of host plant as larvae and drinking nectar as adults. Joe-pye weed, jewelweed and honeysuckle are favorite sources of nectar for the adults.[9] They have also been known to drink nectar from Lantana,[1] as well as thistles, milkweed, azalea, dogbane, mimosa and sweet pepperbush.[8]

Life cycle[edit]

When female swallowtails decide which leaf to oviposit on, they frequently will drum their forelegs toward a leaf to identify it. Their forelegs have chemoreceptors located in the foretarsi that assess the chemical makeup of the leaf and use that information to decide if it is an acceptable spot. In general, females have shorter and denser sensilla on their forelegs than males, which may be a result of their having to sustain frequent heavy strokes.[5]

The eggs of the Spicebush Swallowtail are greenish-white in color, are fairly large and are laid one or two at a time on a spicebush leaf. Once hatched, the young larvae chew through the leaf from the edge to the midrib, about 3/4 of an inch form the tip of the leaf. The larva lies on the midrib and exudes silk. Upon drying, the silk contracts and causes the leaf to fold up around the larva to form a shelter. At first, young larvae are brownish in color.[16] The brown color of the larvae is independent of leaf color and will occur even on a green leaf.[17] A folded leaf serves as the home for the young larvae.[3] During the day, the larvae remain in the shelter so as to avoid predators and come out at night to feed. Additionally, if larvae are disturbed while rolled up in the leaf, they emit a foul-smelling substance.[4]

When these larvae reach later stages, they turn greenish-yellow before pupating. Older larvae live in a leaf, rolled-up and lined with silk and held together by a line of silk.[3] In order to pupate, the larvae will leave the shelter and find the underside of a leaf near the ground to do so.[16] Upon discovery of a suitable leaf, the larvae begin the pupating process by emitting silk from their salivary glands, which helps attach the larvae to the branch or leaf. Then the larvae turn around while still emitting silk, which creates a "safety harness" for the pupating process.[18] At the end of the pupating process, the larvae have become pupae which are either brown (winter) or green (summer).[4]

The practice of turning either brown in winter or green in summer is called seasonal polyphenism.[17] Because the color of the pupa reflects the color of the deciduous host plants, since the leaves will turn brown in winter and green in summer. Even in cases where the leaves are not yet brown, the pupa appear to turn that color in anticipation of the changing colors.[5]

Roughly three generations of Spicebush Swallowtails occur each year. Most develop into adults throughout the range between the months of February and November.[16] The entire development process from egg to adult takes about a month.[19] Once they have reached the adult stage, Papilio troilus can live anywhere from two days to two weeks dependent on resource availability and predator avoidance.[4]

Feeding behavior[edit]

Spicebush Swallowtails (along with P. palamedes) are able to thermoregulate their thoraxes better than other Papilio species, perhaps due to their darker body and wing color. This allows them to fly and feed at lower temperatures than their counterparts.[5]

Social behavior[edit]

Spicebush Swallowtails often engage in "puddling," a type of behavior which occurs while adults are flying in search of food or mates. "Puddling" reflects the fact that while engaging in either feeding or mating behavior, i.e. when they are away from home, Spicebush Swallowtails tend to stay in groups. These groupings are typically located on the banks of water, such as sandy or moist ridges. When "puddling" in these groups, the Papilio troilus will extract moisture from the soil or sand near the water.[4]

Mating behavior[edit]

In general, both sexes will copulate with several different mates during mating season. However, each time a female mates, she becomes less likely to mate again.[4]

One key known form of communication among Spicebush Swallowtails occurs during mating. Visual cues are important for males to find females, and courtship displays can be elaborate. While these courtship displays occur, the female and male are often in contact, which is likely a way for them to relay information to one another.[4] Additionally, the male butterfly will typically emit pheromones around the female butterfly and the female will use their scent to make her decision about mating.[9]

Females can often be found outside the treeline, in areas of direct sun. This may be due to the fact that these areas are in direct sunlight, which allows for higher thoracic temperatures. Males are less concerned with direct sunlight during mating because their thoracic temperature rises while performing vigorous courtship dances. Males may perform these courtship dances both to females perched on host plants as well as those flying freely.[5]

Parental care[edit]

Once eggs are laid, formal parental care ceases among Spicebush Swallowtails. Larvae do have a nutrient-rich egg, which keeps them well-fed during the developmental period. Also, as noted above, females are very particular about host plant choice that aids in the success of egg development.[4]

Predators and avoidance[edit]

Predators[edit]

Many creatures are predators of the Spicebush Swallowtail. These include birds, spiders, robber flies, and dragonflies. All of these creatures will try to eat both adult Spicebush Swallowtail butterflies and youthful larvae.[4]

Last instar, prior to pupation

Mimicry[edit]

The Spicebush Swallowtail’s major form of predator avoidance is through mimicry. Both subspecies and sexes of Papilio troilus have the ability to perform mimicry both as a larva and as an adult.

Larval mimicry[edit]

As larvae, Spicebush Swallowtails have two stages of mimicry. While the larvae are in the early stages, they are dark brown in color and thus appear to resemble bird droppings, which encourages predators to leave them alone.[2] When the larvae have progressed to their fourth and last instar and are nearly ready to pupate, they turn a yellow-green color and are marked by two large black dots with a white highlight. The placement of these dots on the swollen thorax creates the illusion that the caterpillars are common green snakes. Mimicking snakes help the caterpillars to ward off predators, specifically birds. The caterpillar Spicebush Swallowtails enhance the physical resemblance behaviorally, as they have been observed to "rear up and retract the actual caterpillar head."[18]

The osmeterium of the caterpillar also helps to enhance the resemblance to a snake. When attacked, the larvae will expose the osmeterium, a y-shaped organ typically folded up within the caterpillar.[18] For many Spicebush Swallowtails, the osmeterium is red in color, thus creating the illusion of a snake tongue and even further enhancing the disguise.[20]

Larval mimicry, fourth instar.

Adult mimicry[edit]

Adult Spicebush Swallowtails practice another type of mimicry, as they resemble the Pipevine Swallowtail (Battus philenor), a foul-tasting butterfly.[9] Each of the sexes are able to exhibit mimicry of B. philenor successfully, even though the brighter-blue color on female wings is a little more vibrant than the pipevine swallowtail’s coloring.[5] As they themselves are not unapalatable and the pipevine are, this is an example of Batesian mimicry. If predators know that the Pipevine Swallowtail has a foul taste, they are unlikely to eat it and also unlikely to eat the Spicebush Swallowtail.[1] There are other adult butterflies which mimic the poisonous Battus philenor, including Papilio polyxenes, P. glaucus and L. astyanax, but the P. troilus most closely resembles it. However, P. troilus has a greater physical resemblance to the other mimics than it does to B. philenor.[13]

Besides mimicry, another form of predator avoidance for Spicebush Swallowtails is the "club-like extensions from their hind-wings." The swallowtail will employ these during an attack from a predator to attempt to convince the predator to leave them alone.[1]

Cultural references[edit]

In an episode of Murdoch Mysteries, a lepidopterist apparently falls to his death attempting to catch a Papio troilus.

In the Japanese media franchise Pokémon, the Pokemon species Caterpie is based on the caterpillar of a Spicebush Swallowtail or a related swallowtail species.

References[edit]

  1. ^ a b c d "Simply Butterflies," Accessed March 17, 2011, http://www.simplybutterflies.com/Backyard_Butterflies.html
  2. ^ a b Hall, Donald; Butler, Jerry (Aug 2007). "Spicebush Swallowtail," Institute of Food and Agricultural Sciences, University of Florida. http://edis.ifas.ufl.edu/pdffiles/IN/IN32500.pdf
  3. ^ a b c d Scott, James. Butterflies of North America. Stanford: Stanford UP, 1986.
  4. ^ a b c d e f g h i j Mickley, J. and A. Fraser (2006). "Papilio troilus" (On-line), Animal Diversity Web. Accessed March 30, 2011, http://animaldiversity.ummz.umich.edu/site/accounts/information/Papilio_troilus.html
  5. ^ a b c d e f g h Scriber, J., Y. Tsubaki and R. Lederhouse. Swallowtail butterflies: their ecology and evolutionary biology. Scientific Publishers: Gainesville, Fla. 1995.
  6. ^ a b c d e Hamilton, Tyler A. The Swallowtail Butterflies of North America. Naturegraph: Heraldsburg, Calif., 1975.
  7. ^ Scriber, J. Mark, Keegan Keefover and S. Nelson, (2002). "Hot summer temperatures may stop movement of Papilio Canadensis butterflies and genetic introgression south of the hybrid zone in the North American Great Lakes Region." Ecography 25: 184-192.
  8. ^ a b c "Spicebush Swallowtail," Accessed March 14, 2011, http://www.enature.com/flashcard/show_flash_card.asp?recordNumber=BU0123
  9. ^ a b c d Minno, Marc C.; Minno, Maria. Florida Butterfly Gardening: A Complete Guide to Attracting, Identifying, and Enjoying Butterflies of the Lower South. Gainesville: UP of Florida, 1999. Accessed March 17, 2011, http://www.netlibrary.com.ezproxy.rice.edu/Reader/HighlightProxy.aspx?bookid=54768&links=Spicebush,Swallowtail&filename=PAGE_60.html
  10. ^ Klots, Alexander. A Field Guide to Butterflies. Boston: Houghton Mifflin, 1964.
  11. ^ Attributes of Papilio Troilus, Accessed March 17, 2011, http://www.butterfliesandmoths.org/species/Papilio-troilus
  12. ^ a b Nitao, James; Ayres, Matthew; Lederhouse, Robert; Scriber, Mark J. (Aug 1991). "Larval Adaptation to Lauraceous Hosts: Geographic Divergence in the Spicebush Swallowtail Butterfly," Ecology 72 (4): 1428-1435.
  13. ^ a b Carter, Maureen; Feeny, Paul; Haribal, Meena (1999). "An Oviposition Stimulant for Spicebush Swallowtail Butterfly, Papilio Troilus, From Leaves of Sassafras albidum." Journal of Chemical Ecology 25 (6).
  14. ^ a b Scriber, J. Mark, Michelle Larsen, Geoff Allen, Paul Walker and Myron Zalucki, (2008). "Interactions between Papilionidae and ancient Australian angiosperms: evolutionary specialization or ecological monophagy?" Entomologia Experimentalis et Applicata 128: 230-239.
  15. ^ a b "Swallowtail Butterflies," Accessed March 17, 2011, http://www.uky.edu/Ag/CritterFiles/casefile/insects/butterflies/swallowtail/swallowtail.htm
  16. ^ a b c Field Notes from the Beiser Field Station: October 7, 2008, The Spicebush Swallowtail, Accessed March 14, 2011, http://www.marietta.edu/~biol/biomes/spicebush.htm.
  17. ^ a b Shapiro, A.M., (1976). "Seasonal polyphenism." Evolutionary Biology 9: 229-253.
  18. ^ a b c "Spicebush Swallowtail," Accessed March 17, 2011, http://www.carolinanature.com/butterflies/spicebushswt.html
  19. ^ "Tiger Swallowtail Butterfly," Accessed 27 April 2011, http://www.enchantedlearning.com/subjects/butterfly/species/Tigersw.shtml
  20. ^ Brower, Jane Van Zandt (Jun 1958). "Experimental Studies of Mimicry in Some North American Butterflies: Part II. Battus philenor and Papilio Troilus, P. polyxenes and P. glaucus." Evolution 12 (2): 123-136 JSTOR 2406023.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Females are Batesian mimics of Battus philenor.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!